Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6747
Trapped Gene
Klf2 (ENSMUSG00000055148)
Vector Insertion
Chr 8: 74843049 - 74843324
Public Clones HMA500 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213133 (Chr8:74842961..74843048 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCTATCTTGCCGTCCTT Chr8:74842989..74843008 60.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213133 (Chr8:74842961..74843048 +)
Downstram Exon
ENSMUSE00000424021 (Chr8:74843325..74844141 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCTATCTTGCCGTCCTT Chr8:74842989..74843008 60.73 55 TTTAGGTGCGAGCTCTTGGT Chr8:74844121..74844140 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000213133 Chr8:74842961..74843048 GAGCCTATCTTGCCGTCCTT Chr8:74842989..74843008 60.73 55

*** Putative Vector Insertion (Chr 8: 74843049 - 74843324) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000424021 Chr8:74843325..74844141 TTTAGGTGCGAGCTCTTGGT Chr8:74844121..74844140 60.01 50
downstream ENSMUSE00000581769 Chr8:74844643..74845553 ACTTGTCCGGCTCTGTCCTA Chr8:74844934..74844953 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr8:74843098..74843119 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTACGTGACTGGGAAAA Chr8:74843094..74843114 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055148