Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6749
Trapped Gene
Tnpo2 (ENSMUSG00000031691)
Vector Insertion
Chr 8: 87577754 - 87578224
Public Clones HMA058 (baygenomics) A056B05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000581295 (Chr8:87577655..87577753 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTACCAACCTGAACCCTGA Chr8:87577675..87577694 59.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000581295 (Chr8:87577655..87577753 +)
Downstram Exon
ENSMUSE00000496264 (Chr8:87578225..87578320 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTACCAACCTGAACCCTGA Chr8:87577675..87577694 59.82 55 TGGGCCTGTTAATGATCTCC Chr8:87578293..87578312 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606588 Chr8:87560814..87560876 TGGAGAAGCTGCAGCACTTAG Chr8:87560830..87560850 60.85 52.38
upstream ENSMUSE00000480800 Chr8:87562234..87562388 AGTCGCCCAACACAGCTACT Chr8:87562351..87562370 59.94 55
upstream ENSMUSE00000581298 Chr8:87564361..87564436 TCTTTGTCCTGACCAGACTCAA Chr8:87564407..87564428 59.88 45.46
upstream ENSMUSE00000581297 Chr8:87564513..87564662 GGCCTCATCCTCAAGAACAA Chr8:87564536..87564555 60.19 50
upstream ENSMUSE00000476299 Chr8:87568311..87568417 GTGCAACCTGCTCAACTCAG Chr8:87568378..87568397 59.62 55
upstream ENSMUSE00000477305 Chr8:87568501..87568634 TCCTCGGAGCTTTTGGATAG Chr8:87568537..87568556 59.41 50
upstream ENSMUSE00000478044 Chr8:87568725..87568806 AAGCGCTGATGGACAACATT Chr8:87568772..87568791 60.67 45
upstream ENSMUSE00000479084 Chr8:87568882..87569004 TTGGAAGTGCGAATTGACAG Chr8:87568954..87568973 59.84 45
upstream ENSMUSE00000487811 Chr8:87569097..87569215 CCCAGGACCATGATGAGAAC Chr8:87569113..87569132 60.33 55
upstream ENSMUSE00000487867 Chr8:87571020..87571080 CCTCGTGAATGGGATGAAGT Chr8:87571032..87571051 59.93 50
upstream ENSMUSE00000489631 Chr8:87571189..87571354 TTCCACAAGTCACGCACAGT Chr8:87571246..87571265 60.36 50
upstream ENSMUSE00000490673 Chr8:87571482..87571634 CTGCTCAAGGGCCTCCTATT Chr8:87571556..87571575 60.72 55
upstream ENSMUSE00000581296 Chr8:87573835..87574060 GAGCTGATCCCACACCTCAT Chr8:87573867..87573886 60.08 55
upstream ENSMUSE00000486009 Chr8:87574258..87574429 ACTCTCGTTTTTGCCTTTGG Chr8:87574325..87574344 59.35 45
upstream ENSMUSE00000495246 Chr8:87575437..87575523 TGAGCTCAAGGACGAAGACA Chr8:87575481..87575500 59.7 50
upstream ENSMUSE00000514347 Chr8:87575598..87575705 CCCTACTGCGAGCCTGTCTA Chr8:87575640..87575659 60.55 60
upstream ENSMUSE00000515344 Chr8:87575788..87575946 CTTCATGATTGTTGCGTTGG Chr8:87575832..87575851 60.11 45
upstream ENSMUSE00000494411 Chr8:87577358..87577445 CCCTTCTGGGAGACCTTACC Chr8:87577392..87577411 59.93 60
upstream ENSMUSE00000581295 Chr8:87577655..87577753 GGTACCAACCTGAACCCTGA Chr8:87577675..87577694 59.82 55

*** Putative Vector Insertion (Chr 8: 87577754 - 87578224) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496264 Chr8:87578225..87578320 TGGGCCTGTTAATGATCTCC Chr8:87578293..87578312 59.89 50
downstream ENSMUSE00000502489 Chr8:87578591..87578696 CTGGAATGGCAGAGGGACTC Chr8:87578623..87578642 62.13 60
downstream ENSMUSE00000492590 Chr8:87578901..87579000 TTGTCCCGGATGTTCCTAAG Chr8:87578933..87578952 59.93 50
downstream ENSMUSE00000505196 Chr8:87579078..87579152 AACATGTCCCGAAGGTCATC Chr8:87579148..87579167 59.79 50
downstream ENSMUSE00000501702 Chr8:87579239..87579366 CTCCCCAACTTGGTCTTTGA Chr8:87579274..87579293 60.08 50
downstream ENSMUSE00000581293 Chr8:87579450..87581479 GTACCAATCTGGCGTGGTCT Chr8:87580587..87580606 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACTGCCTGCCTCTTCATT Chr8:87577775..87577795 59.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATTGCTCTGTCTCCGTGA Chr8:87577790..87577810 60.56 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031691