Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6757
Trapped Gene
Glul (ENSMUSG00000026473)
Vector Insertion
Chr 1: 155751829 - 155753478
Public Clones HMA290 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661802 (Chr1:155751667..155751828 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGACATGTACCTCCATCCT Chr1:155751724..155751743 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661802 (Chr1:155751667..155751828 +)
Downstram Exon
ENSMUSE00000661801 (Chr1:155753479..155753625 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGACATGTACCTCCATCCT Chr1:155751724..155751743 59.96 55 GCCGTCTGTTCCCATAAGAG Chr1:155753585..155753604 59.69 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661804 Chr1:155747074..155747189 CAGAGCGGAGAATGGGAGTA Chr1:155747075..155747094 60.35 55
upstream ENSMUSE00000537525 Chr1:155750064..155750242 TGATGGTACCGGAGAAGGAC Chr1:155750175..155750194 59.93 55
upstream ENSMUSE00000661802 Chr1:155751667..155751828 GCGACATGTACCTCCATCCT Chr1:155751724..155751743 59.96 55

*** Putative Vector Insertion (Chr 1: 155751829 - 155753478) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661801 Chr1:155753479..155753625 GCCGTCTGTTCCCATAAGAG Chr1:155753585..155753604 59.69 55
downstream ENSMUSE00000537506 Chr1:155754150..155754277 TCCCCGTAATCTTGACTCCA Chr1:155754254..155754273 60.45 50
downstream ENSMUSE00000537503 Chr1:155754416..155754615 ACCCGATGCAAGATAAAACG Chr1:155754498..155754517 59.96 45
downstream ENSMUSE00000595161 Chr1:155754994..155756824 TGCATACCCGATGAGATGAA Chr1:155755568..155755587 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGTGGCTGGCTGTAAATC Chr1:155751844..155751864 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGTGGCTGGCTGTAAATC Chr1:155751844..155751864 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026473