Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6798
Trapped Gene
Sp2 (ENSMUSG00000018678)
Vector Insertion
Chr 11: 96815885 - 96817088
Public Clones RHA041 (baygenomics) (ggtc)
Private Clones OST44823 (lexicon) OST40030 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111019 (Chr11:96817089..96817282 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111019 (Chr11:96817089..96817282 -)
Downstram Exon
ENSMUSE00000585965 (Chr11:96815533..96815884 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673954 Chr11:96844167..96844273 No primer for this exon
upstream ENSMUSE00000673953 Chr11:96842726..96842899 No primer for this exon
upstream ENSMUSE00000673962 Chr11:96838935..96839025 No primer for this exon
upstream ENSMUSE00000673971 Chr11:96838935..96839002 No primer for this exon
upstream ENSMUSE00000673959 Chr11:96829902..96829979 No primer for this exon
upstream ENSMUSE00000371569 Chr11:96824679..96824758 No primer for this exon
upstream ENSMUSE00000673958 Chr11:96824679..96824755 No primer for this exon
upstream ENSMUSE00000673970 Chr11:96824679..96824758 No primer for this exon
upstream ENSMUSE00000414411 Chr11:96822352..96823323 No primer for this exon
upstream ENSMUSE00000111024 Chr11:96818738..96819050 No primer for this exon
upstream ENSMUSE00000111023 Chr11:96817419..96817593 No primer for this exon
upstream ENSMUSE00000111019 Chr11:96817089..96817282 No primer for this exon

*** Putative Vector Insertion (Chr 11: 96815885 - 96817088) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000585965 Chr11:96815533..96815884 No primer for this exon
downstream ENSMUSE00000673957 Chr11:96814787..96815884 No primer for this exon
downstream ENSMUSE00000673960 Chr11:96814655..96815884 No primer for this exon
downstream ENSMUSE00000673964 Chr11:96814654..96815884 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGCCCTTGTCTGTCCTTT Chr11:96817056..96817076 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGCCCTTGTCTGTCCTTT Chr11:96817056..96817076 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAACTCCTCCCCCTACTCT Chr11:96817297..96817317 59.55 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAACTCCTCCCCCTACTCT Chr11:96817297..96817317 59.55 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018678