Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6807
Trapped Gene
Cmc1 (ENSMUSG00000039163)
Vector Insertion
Chr 9: 118024548 - 118059134
Public Clones RHA069 (baygenomics) XC598 (baygenomics) XC898 (baygenomics)
Private Clones OST119405 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688922 (Chr9:118059135..118059198 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGTGGCTTGCTGCTTCT Chr9:118059166..118059185 60.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688922 (Chr9:118059135..118059198 -)
Downstram Exon
ENSMUSE00000326934 (Chr9:118024458..118024547 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGTGGCTTGCTGCTTCT Chr9:118059166..118059185 60.74 55 TCTCGACGTGTCTCAGATGC Chr9:118024502..118024521 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688922 Chr9:118059135..118059198 GTGAGTGGCTTGCTGCTTCT Chr9:118059166..118059185 60.74 55

*** Putative Vector Insertion (Chr 9: 118024548 - 118059134) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326934 Chr9:118024458..118024547 TCTCGACGTGTCTCAGATGC Chr9:118024502..118024521 60.15 55
downstream ENSMUSE00000326914 Chr9:117984240..117984330 AAGGATCCCAGAGTCCTTGC Chr9:117984274..117984293 60.6 55
downstream ENSMUSE00000633728 Chr9:117974213..117974466 CGTAAGACGGGACTTCCTGA Chr9:117974292..117974311 60.25 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTAGGAAGTTTCGGGGTGA Chr9:118059117..118059137 60.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACACCGTGACTGGGAAAAC Chr9:118032068..118032089 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039163