Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6825
Trapped Gene
Clint1 (ENSMUSG00000006169)
Vector Insertion
Chr 11: 45715788 - 45719682
Public Clones RHA181 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104403 (Chr11:45715713..45715787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104403 (Chr11:45715713..45715787 +)
Downstram Exon
ENSMUSE00000471990 (Chr11:45719683..45719969 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679671 Chr11:45665501..45665694 No primer for this exon
upstream ENSMUSE00000679652 Chr11:45665553..45665694 No primer for this exon
upstream ENSMUSE00000679645 Chr11:45695725..45695738 No primer for this exon
upstream ENSMUSE00000679644 Chr11:45695897..45697316 No primer for this exon
upstream ENSMUSE00000467964 Chr11:45697212..45697316 No primer for this exon
upstream ENSMUSE00000422022 Chr11:45697834..45697930 No primer for this exon
upstream ENSMUSE00000354418 Chr11:45699933..45700041 No primer for this exon
upstream ENSMUSE00000249130 Chr11:45700888..45701052 No primer for this exon
upstream ENSMUSE00000249121 Chr11:45704124..45704301 No primer for this exon
upstream ENSMUSE00000104406 Chr11:45707373..45707619 No primer for this exon
upstream ENSMUSE00000104398 Chr11:45708562..45708631 No primer for this exon
upstream ENSMUSE00000104403 Chr11:45715713..45715787 No primer for this exon

*** Putative Vector Insertion (Chr 11: 45715788 - 45719682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471990 Chr11:45719683..45719969 No primer for this exon
downstream ENSMUSE00000679642 Chr11:45719683..45724125 No primer for this exon
downstream ENSMUSE00000249076 Chr11:45721342..45721546 No primer for this exon
downstream ENSMUSE00000679650 Chr11:45721396..45721546 No primer for this exon
downstream ENSMUSE00000473909 Chr11:45722443..45722802 No primer for this exon
downstream ENSMUSE00000679648 Chr11:45722443..45724127 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGTGGGCCTGGATTAGAA Chr11:45718779..45718799 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGTGGGCCTGGATTAGAA Chr11:45718779..45718799 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006169