Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6842
Trapped Gene
Eif3b (ENSMUSG00000056076)
Vector Insertion
Chr 5: 140895781 - 140901215
Public Clones YHA153 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706481 (Chr5:140895315..140895780 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCCGAGGATTTCGTAGAC Chr5:140895745..140895764 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706481 (Chr5:140895315..140895780 +)
Downstram Exon
ENSMUSE00000463882 (Chr5:140901216..140901408 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCCGAGGATTTCGTAGAC Chr5:140895745..140895764 60.33 55 CCTTTCGTCTTTCCGTCCTC Chr5:140901411..140901430 61.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462872 Chr5:140895259..140895780 ACCCCGAGGATTTCGTAGAC Chr5:140895745..140895764 60.33 55
upstream ENSMUSE00000706481 Chr5:140895315..140895780 ACCCCGAGGATTTCGTAGAC Chr5:140895745..140895764 60.33 55

*** Putative Vector Insertion (Chr 5: 140895781 - 140901215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000463882 Chr5:140901216..140901408 CCTTTCGTCTTTCCGTCCTC Chr5:140901411..140901430 61.12 55
downstream ENSMUSE00000461089 Chr5:140902391..140902510 GGGAGAAGCGTACTCCAGAA Chr5:140902421..140902440 59.43 55
downstream ENSMUSE00000462079 Chr5:140902737..140902794 CACTCATCGCTGATCGTCAT Chr5:140902763..140902782 59.82 50
downstream ENSMUSE00000466462 Chr5:140902971..140903099 GGTCCTTGACGTCATTCCAG Chr5:140903079..140903098 60.51 55
downstream ENSMUSE00000467549 Chr5:140903364..140903521 ACGGAGAGAAGTCGATGAGC Chr5:140903517..140903536 59.56 55
downstream ENSMUSE00000464703 Chr5:140906006..140906137 GCTTTCGCAGTGAAAACCTC Chr5:140906117..140906136 60 50
downstream ENSMUSE00000465740 Chr5:140906216..140906282 TTGCAAAGAATTTGCCATCA Chr5:140906247..140906266 60.19 35
downstream ENSMUSE00000495070 Chr5:140906925..140906971 No primer for this exon
downstream ENSMUSE00000495987 Chr5:140908878..140909088 ATGATGTTACCACCCGGAGA Chr5:140908913..140908932 60.19 50
downstream ENSMUSE00000500987 Chr5:140912202..140912274 AGGTACCTGCTTCTCCCTCA Chr5:140912255..140912274 58.89 55
downstream ENSMUSE00000501538 Chr5:140913239..140913361 TTCAATCTTCCCGTTGCTCT Chr5:140913357..140913376 59.81 45
downstream ENSMUSE00000498625 Chr5:140914270..140914348 AGAAGATGGTGTTGGCTTGC Chr5:140914308..140914327 60.26 50
downstream ENSMUSE00000499766 Chr5:140915867..140916005 GTTGGGTCCCATTCAACATC Chr5:140915965..140915984 60.03 50
downstream ENSMUSE00000504465 Chr5:140916940..140917065 GGTCCACAGCCAGTAAGCAT Chr5:140916969..140916988 60.14 55
downstream ENSMUSE00000503205 Chr5:140917691..140917768 AAGCGATCCTTCTGCTCAAA Chr5:140917749..140917768 60.1 45
downstream ENSMUSE00000504091 Chr5:140918078..140918186 AGACGCTCGTTCTTCTGCTT Chr5:140918175..140918194 59.38 50
downstream ENSMUSE00000477070 Chr5:140918274..140918335 CTGTCCAGCTCGTCAGTGTC Chr5:140918301..140918320 59.6 60
downstream ENSMUSE00000648337 Chr5:140918274..140918390 AGGAATGACTTCCTCGGTGA Chr5:140918362..140918381 59.65 50
downstream ENSMUSE00000481881 Chr5:140918338..140918390 AGGAATGACTTCCTCGGTGA Chr5:140918362..140918381 59.65 50
downstream ENSMUSE00000482849 Chr5:140918828..140919314 GGAACAGCAAGTCCGTGAAT Chr5:140919160..140919179 60.12 50
downstream ENSMUSE00000648336 Chr5:140918828..140919312 GGAACAGCAAGTCCGTGAAT Chr5:140919160..140919179 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTAATCGCCTTGCAGCAC Chr5:140898829..140898849 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGGTGCTGAGCATTTGTG Chr5:140898744..140898764 60.31 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056076