Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6843
Trapped Gene
Nono (ENSMUSG00000031311)
Vector Insertion
Chr X: 98625892 - 98632547
Public Clones (sanger) (sanger) YHA266 (baygenomics) D009D04 (ggtc) E089G04 (ggtc)
D147E04 (ggtc) P130D08 (ggtc) E086B07 (ggtc) D147E04 (ggtc) H009E01 (ggtc)
D009D04 (ggtc) E086B07 (ggtc) PST5594-NL (escells) PST11597-NR (escells)
PST9299-NL (escells) PST3061-NR (escells) PST1216-1 (escells) PST23430-NR (escells)
PST13857-NR (escells) PST10457-NR (escells) PST7355-NR (escells) PST5836-NR (escells)
PST17620-NR (escells) PST14938-NR (escells) PST12248-NL (escells) PST5594-NR (escells)
PST7044-NR (escells) PST1157-2 (escells) PST24167-NR (escells) PST234-3 (escells)
PST11426-NR (escells) PST8764-NR (escells) PST5977-NL (escells) PST19411-NL (escells)
PST13349-NL (escells) PST10873-NR (escells) PST6943-NR (escells) PST2842-NR (escells)
PST17299-NR (escells) PST14969-NR (escells) PST12212-NL (escells) PST9300-NL (escells)
PST3686-NR (escells) PST234-1 (escells) PST24006-NR (escells) PST13962-NR (escells)
PST11058-NL (escells) PST8728-NR (escells) PST2962-NR (escells) PST18321-NL (escells)
PST13218-NR (escells) PST4146-NR (escells) PST9473-NR (escells) PST5579-NL (escells)
PST25004-NR (escells) PSTVU01.HE60U (vanderbilt) IST14375H10 (tigm)
IST14717B7 (tigm) IST12457D4 (tigm) IST14717B7 (tigm)
Private Clones OST391184 (lexicon) OST377324 (lexicon) OST291096 (lexicon) OST257641 (lexicon)
OST122499 (lexicon) OST122496 (lexicon) OST120746 (lexicon) OST106720 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208224 (ChrX:98625832..98625891 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGCGAGGCAGACACTTT ChrX:98625849..98625868 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208224 (ChrX:98625832..98625891 +)
Downstram Exon
ENSMUSE00000208229 (ChrX:98632548..98632716 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGCGAGGCAGACACTTT ChrX:98625849..98625868 60.6 55 GTGATGCTGATGATGCTTCC ChrX:98632628..98632647 59.2 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406395 ChrX:98625028..98625101 CCCATACTCCGAGCAAAGAA ChrX:98625069..98625088 60.21 50
upstream ENSMUSE00000208224 ChrX:98625832..98625891 GACTGCGAGGCAGACACTTT ChrX:98625849..98625868 60.6 55

*** Putative Vector Insertion (Chr X: 98625892 - 98632547) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000208229 ChrX:98632548..98632716 GTGATGCTGATGATGCTTCC ChrX:98632628..98632647 59.2 50
downstream ENSMUSE00000208220 ChrX:98634826..98635019 CAAGCGAATAAAGCCAAAGC ChrX:98635022..98635041 59.99 45
downstream ENSMUSE00000287293 ChrX:98636855..98637156 CTTCCTCGGTCATCCACAAT ChrX:98637066..98637085 59.93 50
downstream ENSMUSE00000549050 ChrX:98638269..98638364 ACTGGTCCATAGGCTCCACA ChrX:98638309..98638328 60.53 55
downstream ENSMUSE00000549049 ChrX:98638634..98638830 TGATGTTCCGATCCACTTGA ChrX:98638758..98638777 60.05 45
downstream ENSMUSE00000549048 ChrX:98639616..98639700 CTGCTTTCGCTTCTGAACCT ChrX:98639692..98639711 59.76 50
downstream ENSMUSE00000549046 ChrX:98640027..98640129 GGTTCCCTTGAATCCTTCCT ChrX:98640120..98640139 59.37 50
downstream ENSMUSE00000549044 ChrX:98640634..98640673 GCCCATCCGTATCTCTTGTT ChrX:98640660..98640679 59.01 50
downstream ENSMUSE00000549043 ChrX:98641458..98641567 CAATCCAAGGGTTCCATCTG ChrX:98641570..98641589 60.31 50
downstream ENSMUSE00000372980 ChrX:98642933..98643929 GGCCAAAACGTTCAGTTGTT ChrX:98642963..98642982 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGAACTGTGATTGAAATGTGA ChrX:98628843..98628866 58.27 34.78 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGAACTGTGATTGAAATGTGA ChrX:98628843..98628866 58.27 34.78 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031311