Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6848
Trapped Gene
Ganab (ENSMUSG00000071650)
Vector Insertion
Chr 19: 8972650 - 8976753
Public Clones (sanger) NPX232 (baygenomics) PST26452-NR (escells) IST14184E6 (tigm)
IST11688A3 (tigm) IST14430A12 (tigm)
Private Clones OST404627 (lexicon) OST297970 (lexicon) OST289930 (lexicon) OST222573 (lexicon)
OST211513 (lexicon) OST144678 (lexicon) OST97884 (lexicon) OST89338 (lexicon)
OST86112 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621614 (Chr19:8972580..8972649 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAAACCCGGTACAAGATG Chr19:8972595..8972614 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621614 (Chr19:8972580..8972649 +)
Downstram Exon
ENSMUSE00000621613 (Chr19:8976754..8976858 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAAACCCGGTACAAGATG Chr19:8972595..8972614 59.99 50 CCCCAGACAGACCCCTAAGT Chr19:8976802..8976821 60.36 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621614 Chr19:8972580..8972649 AGCAAACCCGGTACAAGATG Chr19:8972595..8972614 59.99 50

*** Putative Vector Insertion (Chr 19: 8972650 - 8976753) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621613 Chr19:8976754..8976858 CCCCAGACAGACCCCTAAGT Chr19:8976802..8976821 60.36 60
downstream ENSMUSE00000621612 Chr19:8977012..8977120 CAAGGCACGGTAAGGAGAGA Chr19:8977060..8977079 60.39 55
downstream ENSMUSE00000621611 Chr19:8979425..8979552 GGGGTCAGCCACTAAAACAT Chr19:8979544..8979563 58.91 50
downstream ENSMUSE00000621610 Chr19:8981705..8981884 GAATGGCTGTGCTGTCAAAA Chr19:8981795..8981814 59.85 45
downstream ENSMUSE00000621589 Chr19:8982341..8982406 CTACCGAGCGCGAGACTAAC Chr19:8982376..8982395 60.18 60
downstream ENSMUSE00000621609 Chr19:8983168..8983237 CCTTCAGCTGGGTCTTTTGA Chr19:8983197..8983216 60.37 50
downstream ENSMUSE00000621608 Chr19:8983411..8983498 CTCCTGGCTCATCCTTCTCA Chr19:8983456..8983475 60.49 55
downstream ENSMUSE00000621607 Chr19:8983581..8983677 CCTGGCAGAGAAAAGTCCAA Chr19:8983620..8983639 60.37 50
downstream ENSMUSE00000621606 Chr19:8983923..8984103 TCAGCAGCATTAAGCCAGAA Chr19:8984069..8984088 59.71 45
downstream ENSMUSE00000621605 Chr19:8984956..8985109 CCCTGCAGGTAATCAAGCAT Chr19:8984993..8985012 60.1 50
downstream ENSMUSE00000621604 Chr19:8985198..8985433 TTGCCATCAGCATGTTCAAT Chr19:8985357..8985376 60.08 40
downstream ENSMUSE00000621603 Chr19:8985525..8985651 CCCTCGTAATCAGAGCCATC Chr19:8985640..8985659 59.65 55
downstream ENSMUSE00000621602 Chr19:8985767..8985846 TTAGACCACCAGGCCCTCAT Chr19:8985824..8985843 61.81 55
downstream ENSMUSE00000621601 Chr19:8986086..8986229 CACAGCATCCTTCAACATGG Chr19:8986178..8986197 60.11 50
downstream ENSMUSE00000621600 Chr19:8986354..8986450 GAGCGCTGTATTAGCCCATC Chr19:8986391..8986410 59.83 55
downstream ENSMUSE00000621599 Chr19:8986964..8987065 TGCCAGGCTGAGACACATAG Chr19:8987043..8987062 60.01 55
downstream ENSMUSE00000621598 Chr19:8987201..8987444 ATCTCGGATTGCATCTTGGT Chr19:8987364..8987383 59.51 45
downstream ENSMUSE00000621597 Chr19:8988791..8988855 No primer for this exon
downstream ENSMUSE00000621596 Chr19:8989032..8989108 GCATCCGATACAGGGTGAAT Chr19:8989068..8989087 59.78 50
downstream ENSMUSE00000621595 Chr19:8989192..8989266 CTGGCAGATACAAGGTCTGG Chr19:8989255..8989274 58.31 55
downstream ENSMUSE00000621594 Chr19:8989415..8989528 GGGGACTGAGAGCAACAAAG Chr19:8989529..8989548 59.84 55
downstream ENSMUSE00000621593 Chr19:8989648..8989760 ACAGGAACTCATGGCGAGTC Chr19:8989723..8989742 60.27 55
downstream ENSMUSE00000621592 Chr19:8989894..8989994 CAGCCCCCATGATGACTACT Chr19:8989964..8989983 59.95 55
downstream ENSMUSE00000621588 Chr19:8990115..8991153 GCCCTCCTAATTGTGTGGAA Chr19:8990863..8990882 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTCTGCGTAGCTGTTCA Chr19:8975649..8975669 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTCTGCGTAGCTGTTCA Chr19:8975649..8975669 60.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071650