Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6851
Trapped Gene
F630043A04Rik (ENSMUSG00000021965)
Vector Insertion
Chr 14: 58441800 - 58444846
Public Clones (sanger) BGB318 (baygenomics) IST14836G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000402115 (Chr14:58444847..58445000 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACCCCATCCAGAGTTTC Chr14:58444929..58444948 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000402115 (Chr14:58444847..58445000 -)
Downstram Exon
ENSMUSE00000358836 (Chr14:58441738..58441799 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACCCCATCCAGAGTTTC Chr14:58444929..58444948 59.9 50 CTGAATGAAGGTCATGCAAAA Chr14:58441733..58441753 58.76 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402115 Chr14:58444847..58445000 TGAACCCCATCCAGAGTTTC Chr14:58444929..58444948 59.9 50

*** Putative Vector Insertion (Chr 14: 58441800 - 58444846) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358836 Chr14:58441738..58441799 CTGAATGAAGGTCATGCAAAA Chr14:58441733..58441753 58.76 38.1
downstream ENSMUSE00000404945 Chr14:58440873..58441038 GCGCTTGGTAGCCATACTTC Chr14:58440869..58440888 59.87 55
downstream ENSMUSE00000122507 Chr14:58438991..58439399 GGGGTCTCAGCTACACGTTC Chr14:58439140..58439159 59.73 60
downstream ENSMUSE00000356670 Chr14:58435482..58435588 CTGGATTATGGGACCAGGAA Chr14:58435476..58435495 59.74 50
downstream ENSMUSE00000122501 Chr14:58430417..58430502 GTGGCAATGGTGAACTTACG Chr14:58430451..58430470 59.05 50
downstream ENSMUSE00000383724 Chr14:58428780..58428980 CGCAGTAACTTTCGGAGGAG Chr14:58428779..58428798 60.01 55
downstream ENSMUSE00000339775 Chr14:58426812..58426915 TCCGTGGCATCACTTTAACA Chr14:58426833..58426852 60.11 45
downstream ENSMUSE00000459598 Chr14:58425398..58426368 CGGAAACATTCCCGTAAGAA Chr14:58426166..58426185 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGTCCTAATCGCCTTGCAG Chr14:58444781..58444801 63.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAAGCGTGACTGGGAAAA Chr14:58444784..58444804 61.72 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAATGTGTAGCGCGTTCGTT Chr14:58444990..58445010 60.7 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAATGTGTAGCGCGTTCGTT Chr14:58444990..58445010 60.7 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021965