Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6870
Trapped Gene
Samd4b (ENSMUSG00000037513)
Vector Insertion
Chr 7: 29199362 - 29208454
Public Clones (sanger) (sanger) (sanger) BGA578 (baygenomics) D184H08 (ggtc)
D150E11 (ggtc) E052E11 (ggtc) D032D05 (ggtc) IST14892D3 (tigm) IST12455E12 (tigm)
IST11781D11 (tigm) IST11636D4 (tigm)
Private Clones OST466363 (lexicon) OST454964 (lexicon) OST422698 (lexicon) OST355911 (lexicon)
OST299932 (lexicon) OST260737 (lexicon) OST176521 (lexicon) OST66302 (lexicon)
OST58684 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000464193 (Chr7:29208455..29208857 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCTCGCTAGCTGGTTCAA Chr7:29208607..29208626 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000464193 (Chr7:29208455..29208857 -)
Downstram Exon
ENSMUSE00000254387 (Chr7:29198891..29199361 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCTCGCTAGCTGGTTCAA Chr7:29208607..29208626 59.98 50 TGAATGGTAGGAGGGCTCTG Chr7:29199032..29199051 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464193 Chr7:29208455..29208857 ATCCTCGCTAGCTGGTTCAA Chr7:29208607..29208626 59.98 50

*** Putative Vector Insertion (Chr 7: 29199362 - 29208454) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254387 Chr7:29198891..29199361 TGAATGGTAGGAGGGCTCTG Chr7:29199032..29199051 60.21 55
downstream ENSMUSE00000254399 Chr7:29192955..29193194 GGCTCGTAGGGATGAGTGAC Chr7:29193110..29193129 59.69 60
downstream ENSMUSE00000254467 Chr7:29192488..29192597 CTGCGACTCTAGGTGCTGCT Chr7:29192466..29192485 60.9 60
downstream ENSMUSE00000254458 Chr7:29192250..29192336 GGACTTGAGGACGCTCTGTC Chr7:29192237..29192256 59.99 60
downstream ENSMUSE00000254452 Chr7:29191388..29191706 GACCCTCATCCTTGGCAGTA Chr7:29191567..29191586 60.07 55
downstream ENSMUSE00000254442 Chr7:29190973..29191058 CTTTTCGATGAGCTGGAGGT Chr7:29190966..29190985 59.43 50
downstream ENSMUSE00000254432 Chr7:29190508..29190626 GAATGTCCGGAGGAGTTTCA Chr7:29190533..29190552 60.05 50
downstream ENSMUSE00000254423 Chr7:29188883..29189081 GGCATGTCGAGGAGAGACAC Chr7:29188897..29188916 60.84 60
downstream ENSMUSE00000254416 Chr7:29188639..29188762 TGAGAATAGCCTGGGGTGAC Chr7:29188629..29188648 60.07 55
downstream ENSMUSE00000254413 Chr7:29186843..29186926 AAGGCGTGTTCTGTCATGCT Chr7:29186826..29186845 60.87 50
downstream ENSMUSE00000535275 Chr7:29185319..29186636 GGGTGGGAAAGTTTGACAGA Chr7:29185634..29185653 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGCAGTAATCGCCTTGC Chr7:29208391..29208411 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGTCCTGTCACTTCACC Chr7:29205417..29205437 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAACTTGCATTCCAGCACCT Chr7:29208826..29208846 59.74 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAACTTGCATTCCAGCACCT Chr7:29208826..29208846 59.74 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037513