Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6892
Trapped Gene
Trim32 (ENSMUSG00000051675)
Vector Insertion
Chr 4: 65274165 - 65277272
Public Clones BGA355 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337626 (Chr4:65274163..65277271 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACAGCGGAGTTCTGAGG Chr4:65275270..65275289 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337626 (Chr4:65274163..65277271 +)
Downstram Exon
ENSMUSE00000672891 (Chr4:65274166..65277272 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACAGCGGAGTTCTGAGG Chr4:65275270..65275289 59.99 55 CCTCAGAACTCCGCTGTTTC Chr4:65275292..65275311 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672892 Chr4:65266020..65266103 No primer for this exon
upstream ENSMUSE00000403686 Chr4:65266052..65266103 No primer for this exon
upstream ENSMUSE00000337626 Chr4:65274163..65277271 GAAACAGCGGAGTTCTGAGG Chr4:65275270..65275289 59.99 55

*** Putative Vector Insertion (Chr 4: 65274165 - 65277272) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672891 Chr4:65274166..65277272 CCTCAGAACTCCGCTGTTTC Chr4:65275292..65275311 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGCATGAATATTAAGCTG Chr4:65274178..65274199 59.94 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTAAGCTGTGCGTGACTGG Chr4:65274205..65274225 60.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051675