Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6904
Trapped Gene
Ubr4 (ENSMUSG00000066036)
Vector Insertion
Chr 4: 138998600 - 138998739
Public Clones BGB003 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000667579 (Chr4:138998601..138998738 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCAGCCTCAGATGACGAG Chr4:138998601..138998620 61.11 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000667579 (Chr4:138998601..138998738 +)
Downstram Exon
ENSMUSE00000524431 (Chr4:138998601..138998738 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCAGCCTCAGATGACGAG Chr4:138998601..138998620 61.11 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377299 Chr4:138936602..138936777 CTACTCCGCCTTCGAGATGA Chr4:138936721..138936740 60.49 55
upstream ENSMUSE00000347588 Chr4:138944283..138944380 CACCACGAGAAGCAGTACGA Chr4:138944299..138944318 60.05 55
upstream ENSMUSE00000403106 Chr4:138946755..138946858 GAGTTTTCCCTCCTGCGTCT Chr4:138946805..138946824 60.77 55
upstream ENSMUSE00000343228 Chr4:138947700..138947829 GCCAAGCTTCCACAGACAGT Chr4:138947793..138947812 60.45 55
upstream ENSMUSE00000399791 Chr4:138947935..138948074 CTCCTCCCATCAGTCCACAG Chr4:138948049..138948068 60.67 60
upstream ENSMUSE00000352042 Chr4:138948699..138948801 GCTGCCAAGACCAAGAGTGT Chr4:138948744..138948763 60.45 55
upstream ENSMUSE00000376224 Chr4:138948932..138949073 GTATGCCTGAACCTGCCCTA Chr4:138948955..138948974 60.1 55
upstream ENSMUSE00000338486 Chr4:138949210..138949334 CCCTCAATCCTTCTCGTCTG Chr4:138949275..138949294 59.8 55
upstream ENSMUSE00000374176 Chr4:138952472..138952596 CAGCCACGATTGTTCAGAAA Chr4:138952574..138952593 59.84 45
upstream ENSMUSE00000409305 Chr4:138953068..138953127 No primer for this exon
upstream ENSMUSE00000596698 Chr4:138953209..138953399 CTGGTGCCTGCTTAATAGCC Chr4:138953238..138953257 59.87 55
upstream ENSMUSE00000596697 Chr4:138955477..138955576 CTCGGTGATACTGGCAAACC Chr4:138955498..138955517 60.52 55
upstream ENSMUSE00000596696 Chr4:138955712..138955849 TCAACGGCTGATTGACTCTG Chr4:138955780..138955799 59.98 50
upstream ENSMUSE00000596695 Chr4:138956240..138956357 TAGCACAGAGGAGGACAGCA Chr4:138956332..138956351 59.73 55
upstream ENSMUSE00000596694 Chr4:138957196..138957383 GCTCTCCTCGGGTTAAAAGC Chr4:138957301..138957320 60.34 55
upstream ENSMUSE00000596693 Chr4:138958424..138958583 ATCTGAGCGCCTCTCTCTCA Chr4:138958503..138958522 60.4 55
upstream ENSMUSE00000596692 Chr4:138958662..138958747 ACCACTCGCTGGTGACTTCT Chr4:138958704..138958723 59.91 55
upstream ENSMUSE00000596691 Chr4:138962394..138962563 CCCTGAATGCCTGAAAGTGT Chr4:138962537..138962556 60.11 50
upstream ENSMUSE00000596690 Chr4:138963628..138963910 GAGCCATCTTGACCATGCTT Chr4:138963753..138963772 60.23 50
upstream ENSMUSE00000596689 Chr4:138964455..138964590 AGTGGATCCCAAGACAGCAG Chr4:138964494..138964513 60.26 55
upstream ENSMUSE00000596688 Chr4:138964754..138964833 GGTTCTACTGCGTCCTGTCC Chr4:138964772..138964791 59.73 60
upstream ENSMUSE00000596687 Chr4:138965588..138965716 TCCAAGCCTGTCAAGTACGA Chr4:138965606..138965625 59.44 50
upstream ENSMUSE00000596686 Chr4:138966003..138966185 GCCTCCGGATCAGTTCCTAT Chr4:138966151..138966170 60.43 55
upstream ENSMUSE00000596685 Chr4:138966322..138966444 GAGGAGTACTTTGCCCGACA Chr4:138966424..138966443 60.26 55
upstream ENSMUSE00000596684 Chr4:138966537..138966766 ACACCTATGCCTCGTTCACC Chr4:138966745..138966764 60 55
upstream ENSMUSE00000596683 Chr4:138968541..138968662 GCTATCGGCTCCAGTAGGTG Chr4:138968626..138968645 59.86 60
upstream ENSMUSE00000596682 Chr4:138969327..138969424 TTTCCCAACATTGGATCCTG Chr4:138969404..138969423 60.69 45
upstream ENSMUSE00000596681 Chr4:138970258..138970415 TCCCGTCCGAGAGTTACATC Chr4:138970283..138970302 60.07 55
upstream ENSMUSE00000524437 Chr4:138970385..138970415 No primer for this exon
upstream ENSMUSE00000281754 Chr4:138970915..138971124 CAGGTGATCCGGACTCTGTT Chr4:138970940..138970959 60.11 55
upstream ENSMUSE00000281745 Chr4:138972468..138972569 TCCATCCTGGAGGAGTGTTT Chr4:138972481..138972500 59.51 50
upstream ENSMUSE00000281739 Chr4:138972771..138972871 CCAATGAGGACCTCTCTGCT Chr4:138972803..138972822 59.4 55
upstream ENSMUSE00000281733 Chr4:138973106..138973304 CTGACCAGCTGGAGGTCATT Chr4:138973229..138973248 60.26 55
upstream ENSMUSE00000281724 Chr4:138974317..138974505 GCCACCTTCAGCTTCACAAT Chr4:138974460..138974479 60.26 50
upstream ENSMUSE00000281715 Chr4:138975083..138975146 TGAGAAGCTGAATGCCAATG Chr4:138975113..138975132 59.95 45
upstream ENSMUSE00000281709 Chr4:138976294..138976485 GTGGAAGAGTTAGCGGTGGA Chr4:138976438..138976457 60.26 55
upstream ENSMUSE00000281701 Chr4:138976996..138977066 No primer for this exon
upstream ENSMUSE00000281693 Chr4:138977146..138977293 CCTACGCCAAGTATGGTTCC Chr4:138977232..138977251 59.45 55
upstream ENSMUSE00000281686 Chr4:138977612..138977839 AGGGTTTCCGAAAGTCTGGT Chr4:138977684..138977703 59.97 50
upstream ENSMUSE00000281679 Chr4:138978308..138978478 GTGGACAAGGGTGTGGAGAT Chr4:138978443..138978462 59.82 55
upstream ENSMUSE00000343345 Chr4:138979742..138979924 ACAGGAAGGTGCCTTTGAGA Chr4:138979759..138979778 59.84 50
upstream ENSMUSE00000281660 Chr4:138980675..138980833 CTTACTGGAAACCCCTGCAA Chr4:138980783..138980802 60.1 50
upstream ENSMUSE00000281654 Chr4:138981128..138981280 GGCTCTGTCTCCGATCACTT Chr4:138981158..138981177 59.41 55
upstream ENSMUSE00000281646 Chr4:138981614..138981841 TGCCTTGAGTCCAACCTTCT Chr4:138981634..138981653 59.84 50
upstream ENSMUSE00000281640 Chr4:138982693..138982850 CAGCTACAGTCAGGGCAGGT Chr4:138982764..138982783 60.47 60
upstream ENSMUSE00000281634 Chr4:138983950..138984121 AGTGGTCCGAGGTGATGAAC Chr4:138983988..138984007 59.97 55
upstream ENSMUSE00000281627 Chr4:138984405..138984606 AGCGCAAAACAGCTACCATC Chr4:138984586..138984605 60.42 50
upstream ENSMUSE00000281606 Chr4:138985407..138985570 TTTGGCGGTAATGACCTCTT Chr4:138985481..138985500 59.57 45
upstream ENSMUSE00000281598 Chr4:138986039..138986255 TGGTTTGACTTCCCCTTCAC Chr4:138986192..138986211 59.94 50
upstream ENSMUSE00000281592 Chr4:138987460..138987676 CATCTGCCCTCCTAACCTGA Chr4:138987587..138987606 60.21 55
upstream ENSMUSE00000416497 Chr4:138988397..138988429 GAGTCCCTAACCAAGCTGGA Chr4:138988407..138988426 59.28 55
upstream ENSMUSE00000596680 Chr4:138989535..138989598 TTGGCCCAATCATTGAGAAG Chr4:138989579..138989598 60.97 45
upstream ENSMUSE00000596679 Chr4:138989909..138990043 AGCAATCAAAGAGCCTCCTG Chr4:138989982..138990001 59.57 50
upstream ENSMUSE00000281580 Chr4:138990925..138991099 GTCACACGCCCTAACAACCT Chr4:138991039..138991058 60.03 55
upstream ENSMUSE00000667584 Chr4:138991864..138991947 AGATGTGCCTGCTGGAATCTA Chr4:138991878..138991898 59.85 47.62
upstream ENSMUSE00000416475 Chr4:138992037..138992174 CAGGAAGGAGACGGCTGTAG Chr4:138992069..138992088 60.01 60
upstream ENSMUSE00000524435 Chr4:138992988..138993109 GCTACGGTTAATGCGTTGGT Chr4:138993005..138993024 60.03 50
upstream ENSMUSE00000714688 Chr4:138993965..138994076 CCTCGAAGCAACACTCCAAT Chr4:138994055..138994074 60.26 50
upstream ENSMUSE00000715787 Chr4:138993965..138994076 CCTCGAAGCAACACTCCAAT Chr4:138994055..138994074 60.26 50
upstream ENSMUSE00000524433 Chr4:138996326..138996456 GACGATGACGCAGATGAGAA Chr4:138996346..138996365 59.95 50
upstream ENSMUSE00000667582 Chr4:138996326..138996456 GACGATGACGCAGATGAGAA Chr4:138996346..138996365 59.95 50
upstream ENSMUSE00000524432 Chr4:138996560..138996737 GAGTCGATGGTCCTGGAAAC Chr4:138996563..138996582 59.51 55
upstream ENSMUSE00000667581 Chr4:138996560..138996737 GAGTCGATGGTCCTGGAAAC Chr4:138996563..138996582 59.51 55
upstream ENSMUSE00000365965 Chr4:138997107..138997211 CAGGAACCCTCTCTGACACC Chr4:138997182..138997201 59.68 60
upstream ENSMUSE00000667580 Chr4:138997107..138997211 CAGGAACCCTCTCTGACACC Chr4:138997182..138997201 59.68 60

*** Putative Vector Insertion (Chr 4: 138998600 - 138998739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000524431 Chr4:138998601..138998738 No primer for this exon
downstream ENSMUSE00000667579 Chr4:138998601..138998738 No primer for this exon
downstream ENSMUSE00000524430 Chr4:138999314..138999488 CGTCACCATATGCACTGCTC Chr4:138999346..138999365 60.3 55
downstream ENSMUSE00000630777 Chr4:138999314..138999488 CGTCACCATATGCACTGCTC Chr4:138999346..138999365 60.3 55
downstream ENSMUSE00000524429 Chr4:139000510..139000606 CAGCATCAGACGAACCATGT Chr4:139000537..139000556 59.71 50
downstream ENSMUSE00000630798 Chr4:139000510..139000606 CAGCATCAGACGAACCATGT Chr4:139000537..139000556 59.71 50
downstream ENSMUSE00000524428 Chr4:139001159..139001266 CTTTTTGTCCATGCCCAACT Chr4:139001269..139001288 59.97 45
downstream ENSMUSE00000667578 Chr4:139001159..139001266 CTTTTTGTCCATGCCCAACT Chr4:139001269..139001288 59.97 45
downstream ENSMUSE00000524427 Chr4:139001774..139001890 TCTCATCACGACCAAATGGA Chr4:139001836..139001855 60.05 45
downstream ENSMUSE00000667577 Chr4:139001774..139001890 TCTCATCACGACCAAATGGA Chr4:139001836..139001855 60.05 45
downstream ENSMUSE00000524426 Chr4:139002774..139002983 TACTGGCGGAGAAAGAATGG Chr4:139002979..139002998 60.21 50
downstream ENSMUSE00000667576 Chr4:139002774..139002983 TACTGGCGGAGAAAGAATGG Chr4:139002979..139002998 60.21 50
downstream ENSMUSE00000524391 Chr4:139004737..139004886 TGGTGTCTGCGATCTTCTTG Chr4:139004833..139004852 59.98 50
downstream ENSMUSE00000524425 Chr4:139004737..139004886 TGGTGTCTGCGATCTTCTTG Chr4:139004833..139004852 59.98 50
downstream ENSMUSE00000281547 Chr4:139006230..139006457 TCGGAGCTGTCGGTATTTCT Chr4:139006328..139006347 59.84 50
downstream ENSMUSE00000667575 Chr4:139006230..139006457 TCGGAGCTGTCGGTATTTCT Chr4:139006328..139006347 59.84 50
downstream ENSMUSE00000281542 Chr4:139007161..139007239 No primer for this exon
downstream ENSMUSE00000667574 Chr4:139007161..139007239 No primer for this exon
downstream ENSMUSE00000281540 Chr4:139007643..139007887 TTGGACTGAGTTGTGGCTTG Chr4:139007841..139007860 59.87 50
downstream ENSMUSE00000487099 Chr4:139007643..139007888 TTGGACTGAGTTGTGGCTTG Chr4:139007841..139007860 59.87 50
downstream ENSMUSE00000667573 Chr4:139007643..139007848 TTGGACTGAGTTGTGGCTTG Chr4:139007841..139007860 59.87 50
downstream ENSMUSE00000281536 Chr4:139008486..139008654 AAACAGCGCAGAAACTGGAT Chr4:139008591..139008610 59.88 45
downstream ENSMUSE00000281533 Chr4:139009050..139009194 GCTGAGCCTTGTTGGAGTTT Chr4:139009072..139009091 59.48 50
downstream ENSMUSE00000281526 Chr4:139009887..139009972 GAGTTGGGGTGATTGGTGAG Chr4:139009963..139009982 60.36 55
downstream ENSMUSE00000281519 Chr4:139011082..139011169 GCCGTCAAACTCCACTAAGC Chr4:139011115..139011134 59.88 55
downstream ENSMUSE00000281514 Chr4:139011363..139011556 GTCACCTTGCTGATGGTGTG Chr4:139011460..139011479 60.16 55
downstream ENSMUSE00000281508 Chr4:139013447..139013686 CTTCTGTCTGTCCGGGAGTC Chr4:139013505..139013524 59.83 60
downstream ENSMUSE00000281503 Chr4:139014010..139014148 CAAGGCTTGGCATAAAGCAT Chr4:139014108..139014127 60.23 45
downstream ENSMUSE00000281191 Chr4:139014714..139014839 GCAGAGCAGGTTCTCCAACT Chr4:139014809..139014828 59.6 55
downstream ENSMUSE00000281184 Chr4:139014941..139015069 TGCAGGATGTAGCGATTCAC Chr4:139015008..139015027 59.83 50
downstream ENSMUSE00000375047 Chr4:139015914..139016257 CAAAGAGCTCTCGGATGAGG Chr4:139016190..139016209 60.09 55
downstream ENSMUSE00000281168 Chr4:139017743..139017833 TGATCAGGTCGTTCATTTGC Chr4:139017786..139017805 59.65 45
downstream ENSMUSE00000281473 Chr4:139018093..139018177 GATGGAATCTGTCAGCAGCA Chr4:139018140..139018159 59.95 50
downstream ENSMUSE00000281462 Chr4:139018317..139018444 ACAACCACTGGCGTTTTGAT Chr4:139018368..139018387 60.42 45
downstream ENSMUSE00000596699 Chr4:139019195..139019324 ATAGGCAGGCACTTCTTCCA Chr4:139019322..139019341 59.84 50
downstream ENSMUSE00000281442 Chr4:139019413..139019570 CCACACGTACTTCTCGGTCA Chr4:139019489..139019508 59.74 55
downstream ENSMUSE00000281429 Chr4:139019900..139020009 AGCTTCCACGATGGTACAGG Chr4:139019962..139019981 60.13 55
downstream ENSMUSE00000281419 Chr4:139020457..139020598 AGGCGATGAGCTTCTGGTAG Chr4:139020533..139020552 59.6 55
downstream ENSMUSE00000281410 Chr4:139020874..139020955 No primer for this exon
downstream ENSMUSE00000281401 Chr4:139021209..139021382 AGCACAGGTACCCATTCAGC Chr4:139021301..139021320 60.14 55
downstream ENSMUSE00000281388 Chr4:139023128..139023249 CAGATTGTAGCGCTTTGCTG Chr4:139023195..139023214 59.78 50
downstream ENSMUSE00000281382 Chr4:139023921..139024118 GCATCCTGCCCTGTAGAAAG Chr4:139024002..139024021 59.84 55
downstream ENSMUSE00000281376 Chr4:139024705..139024785 CGGGAAGGTCCAGACTGATA Chr4:139024747..139024766 60.06 55
downstream ENSMUSE00000415964 Chr4:139025591..139025678 CCCGCATTCGATAAACAATC Chr4:139025627..139025646 60.29 45
downstream ENSMUSE00000281364 Chr4:139026114..139026241 ACCGGCCATTCTGTACACTT Chr4:139026157..139026176 59.48 50
downstream ENSMUSE00000281359 Chr4:139027220..139027327 AGAGTCCCCAGCATGACATT Chr4:139027323..139027342 59.53 50
downstream ENSMUSE00000281354 Chr4:139027647..139027766 GCTCTGCGTTGGATTCATCT Chr4:139027752..139027771 60.37 50
downstream ENSMUSE00000281347 Chr4:139028387..139028577 TCTCCGAAGGACAGGTATGG Chr4:139028523..139028542 60.06 55
downstream ENSMUSE00000281340 Chr4:139028986..139029159 CTTGATACCGGCAGCAATTT Chr4:139029061..139029080 60.1 45
downstream ENSMUSE00000281332 Chr4:139029452..139029551 TTTCCAGATGTCAGCATCCA Chr4:139029476..139029495 60.2 45
downstream ENSMUSE00000281324 Chr4:139032046..139032264 AGCTTATGCAGGCTCGTGAT Chr4:139032089..139032108 60.01 50
downstream ENSMUSE00000281314 Chr4:139033043..139033156 CAGGAGTGCAGTCTTGGTCA Chr4:139033087..139033106 60.02 55
downstream ENSMUSE00000181734 Chr4:139034833..139034975 ACCCGCTTGGTGAAAGTGTA Chr4:139034876..139034895 60.55 50
downstream ENSMUSE00000181727 Chr4:139035365..139035490 CAAGTGGCGAAAGCTGATTC Chr4:139035484..139035503 60.91 50
downstream ENSMUSE00000181728 Chr4:139036557..139036751 TCCTGGAGGTACGTGTTGTG Chr4:139036580..139036599 59.59 55
downstream ENSMUSE00000181733 Chr4:139038373..139038597 TCCACTTCTCTTTGGGCTGT Chr4:139038443..139038462 59.84 50
downstream ENSMUSE00000181732 Chr4:139041200..139041290 TAGTCCTTCACCGCCTTGTC Chr4:139041229..139041248 60.26 55
downstream ENSMUSE00000181730 Chr4:139041900..139042062 AGCCGCCCTCAGTGTTACTA Chr4:139041933..139041952 59.9 55
downstream ENSMUSE00000596678 Chr4:139045082..139045444 CCACTCCGAGAAAACTGAGG Chr4:139045274..139045293 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCAGCTCCAGCCTCAGAT Chr4:138998596..138998616 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCAGCTCCAGCCTCAGAT Chr4:138998596..138998616 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066036