Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6913
Trapped Gene
Atp11c (ENSMUSG00000062949)
Vector Insertion
Chr X: 57574731 - 57656979
Public Clones RRX137 (baygenomics) RRM203 (baygenomics) IST14639G2 (tigm) IST11922E4 (tigm)
IST14096B3 (tigm) IST10252E2 (tigm) IST14329D6 (tigm)
Private Clones OST33486 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454335 (ChrX:57656980..57657156 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454335 (ChrX:57656980..57657156 -)
Downstram Exon
ENSMUSE00000655595 (ChrX:57574611..57574730 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACTGTGCGTGTACCAACTCG ChrX:57574671..57574690 59.82 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454335 ChrX:57656980..57657156 No primer for this exon

*** Putative Vector Insertion (Chr X: 57574731 - 57656979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655595 ChrX:57574611..57574730 ACTGTGCGTGTACCAACTCG ChrX:57574671..57574690 59.82 55
downstream ENSMUSE00000655594 ChrX:57562893..57562982 TTCTTAGGGAGGAAATTCCAAA ChrX:57562932..57562953 59.1 36.36
downstream ENSMUSE00000655593 ChrX:57560374..57560454 CACTGGTAACTGGGCTGGTT ChrX:57560396..57560415 60.03 55
downstream ENSMUSE00000655592 ChrX:57557402..57557509 TCTTTCCTCACTCGCTTTGC ChrX:57557396..57557415 60.66 50
downstream ENSMUSE00000655591 ChrX:57550138..57550266 GTTCCATCAGTTGTGCAGGA ChrX:57550162..57550181 59.68 50
downstream ENSMUSE00000655590 ChrX:57548366..57548469 GAGATCAGGTTGAGGCTGCT ChrX:57548349..57548368 59.56 55
downstream ENSMUSE00000655589 ChrX:57546784..57546834 No primer for this exon
downstream ENSMUSE00000655587 ChrX:57545496..57545560 AAGTGTGGCTCCTTTCAGCA ChrX:57545496..57545515 60.97 50
downstream ENSMUSE00000655586 ChrX:57545097..57545178 CCATCCCAGTGTAAACAGCA ChrX:57545133..57545152 59.57 50
downstream ENSMUSE00000655585 ChrX:57543747..57543897 TGCATACTGCAGCTTTGGTC ChrX:57543814..57543833 60.02 50
downstream ENSMUSE00000655584 ChrX:57543071..57543268 No primer for this exon
downstream ENSMUSE00000655583 ChrX:57534745..57534906 GGGCCCATCAGTCTGAGATA ChrX:57534750..57534769 60.03 55
downstream ENSMUSE00000655581 ChrX:57533834..57533985 TATGTGAATCCGGCTCCTTC ChrX:57533860..57533879 60.04 50
downstream ENSMUSE00000655580 ChrX:57533209..57533280 CCCAAAAATGTGAACCCAAA ChrX:57533238..57533257 60.57 40
downstream ENSMUSE00000655579 ChrX:57531971..57532044 ATACGTCGGCGGACAGAATC ChrX:57531975..57531994 62.33 55
downstream ENSMUSE00000655578 ChrX:57530554..57530657 TGCATTACGTTCCACATGGT ChrX:57530535..57530554 59.85 45
downstream ENSMUSE00000655577 ChrX:57529785..57529966 TCTTGTAGGGCCATTTTTGC ChrX:57529844..57529863 60.07 45
downstream ENSMUSE00000655576 ChrX:57522911..57523174 AATGGTCTCTGCAGCCTGAT ChrX:57523125..57523144 59.83 50
downstream ENSMUSE00000488920 ChrX:57519913..57520087 TCCTGATGTTCTGTCCATGC ChrX:57520045..57520064 59.64 50
downstream ENSMUSE00000206791 ChrX:57514829..57514931 TTGGCACCATCACCTATTGA ChrX:57514845..57514864 59.92 45
downstream ENSMUSE00000206797 ChrX:57513338..57513483 CTTGACGGCCTTCTTTTCCT ChrX:57513435..57513454 60.73 50
downstream ENSMUSE00000488021 ChrX:57501066..57501125 TGGCAAAATGAAACAAAGGTT ChrX:57501083..57501103 59.48 33.33
downstream ENSMUSE00000206784 ChrX:57498341..57498468 GGGTCTGCGGTCAGAGTATC ChrX:57498331..57498350 59.69 60
downstream ENSMUSE00000206779 ChrX:57495939..57496074 AATGTAAGAAGGGCCCCAAC ChrX:57496006..57496025 60.19 50
downstream ENSMUSE00000206794 ChrX:57493950..57494015 AACAATGGTTCCAAATGTCCA ChrX:57493961..57493981 60.08 38.1
downstream ENSMUSE00000206774 ChrX:57491647..57491750 TCCTCCCCAGAAGAATGAGA ChrX:57491633..57491652 59.73 50
downstream ENSMUSE00000498939 ChrX:57489734..57489887 CAGAGCATTTGAGCAAACACA ChrX:57489815..57489835 60.04 42.86
downstream ENSMUSE00000655574 ChrX:57482325..57482429 GAAGGTCTGGCGGATAATGA ChrX:57482358..57482377 60.04 50
downstream ENSMUSE00000453967 ChrX:57476470..57478970 CTGCAACCACGGTCAATATG ChrX:57478890..57478909 59.99 50
downstream ENSMUSE00000655575 ChrX:57476470..57478970 CTGCAACCACGGTCAATATG ChrX:57478890..57478909 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT ChrX:57617909..57617929 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAATGTCTTTGCCGTGAC ChrX:57617922..57617942 58.57 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCATTGGATTTGGCAAGTT ChrX:57618142..57618162 60.31 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCATTGGATTTGGCAAGTT ChrX:57618142..57618162 60.31 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062949