Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6916
Trapped Gene
Eif2s2 (ENSMUSG00000074656)
Vector Insertion
Chr 2: 154714097 - 154718425
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) XH413 (baygenomics)
RRZ655 (baygenomics) M018B01 (ggtc) 5SP138H04 (ggtc) 3SP116F01 (ggtc)
P105C09 (ggtc) E056C12 (ggtc) 5SE065F02 (ggtc) P067F06 (ggtc) 3SP125C01 (ggtc)
H002F11 (ggtc) 3SP138H04 (ggtc) 5SP105C09 (ggtc) P116F01 (ggtc)
3SP133D02 (ggtc) P008A02 (ggtc) 5SP139D02 (ggtc) 5SP116F01 (ggtc)
(ggtc) P125C01 (ggtc) 3SP138A01 (ggtc) 5SH002F11 (ggtc) M124F01 (ggtc)
5SP125C01 (ggtc) CMHD-GT_472H7-3 (cmhd) (cmhd) CMHD-GT_392H2-3 (cmhd)
FHCRC-GT-S6-7H1 (fhcrc) PST22940-NR (escells) PST10405-NR (escells) PST20214-NL (escells)
IST10891F8 (tigm) IST14535D11 (tigm)
Private Clones OST341874 (lexicon) OST336780 (lexicon) OST285963 (lexicon) OST184804 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681253 (Chr2:154718426..154718553 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGGTGCTGTGAGAAGTAT Chr2:154718523..154718542 59.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681253 (Chr2:154718426..154718553 -)
Downstram Exon
ENSMUSE00000639772 (Chr2:154713919..154714096 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGGTGCTGTGAGAAGTAT Chr2:154718523..154718542 59.47 50 GCGTCCACGTCTTTTTCTTC Chr2:154713923..154713942 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681253 Chr2:154718426..154718553 TGCGGTGCTGTGAGAAGTAT Chr2:154718523..154718542 59.47 50

*** Putative Vector Insertion (Chr 2: 154714097 - 154718425) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639772 Chr2:154713919..154714096 GCGTCCACGTCTTTTTCTTC Chr2:154713923..154713942 59.86 50
downstream ENSMUSE00000639771 Chr2:154713440..154713543 No primer for this exon
downstream ENSMUSE00000639770 Chr2:154710047..154710182 TGCCAAGCATAATGTCAAGG Chr2:154710091..154710110 59.69 45
downstream ENSMUSE00000639769 Chr2:154704206..154704300 CCAAGCAGTTTGGCTACTGA Chr2:154704217..154704236 59.07 50
downstream ENSMUSE00000639767 Chr2:154703407..154703555 GTTGAACACTCGGTTCAGCA Chr2:154703513..154703532 59.88 50
downstream ENSMUSE00000639766 Chr2:154702352..154702408 AGGAGATGTTTGGGTTGACG Chr2:154702360..154702379 59.97 50
downstream ENSMUSE00000639765 Chr2:154699285..154699370 No primer for this exon
downstream ENSMUSE00000639763 Chr2:154698173..154698636 TGTAGGATTGTGTCCGGTGA Chr2:154698566..154698585 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACTGGACTTGCTTTTGGT Chr2:154718421..154718441 60.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACTGGACTTGCTTTTGGT Chr2:154718421..154718441 60.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTTTGCCCTTATGCCAAGTC Chr2:154718534..154718554 59.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGCTACGCTGACGTGACTG Chr2:154718495..154718515 59.8 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074656