Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6919
Trapped Gene
Pard3 (ENSMUSG00000025812)
Vector Insertion
Chr 8: 129998516 - 130116960
Public Clones RRZ644 (baygenomics) IST13601G10 (tigm)
Private Clones OST301855 (lexicon) OST209921 (lexicon) OST48725 (lexicon) OST40810 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314786 (Chr8:129998279..129998515 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATTTCCATCGGACGTTTG Chr8:129998345..129998364 59.93 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314786 (Chr8:129998279..129998515 +)
Downstram Exon
ENSMUSE00000314783 (Chr8:130116961..130117081 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATTTCCATCGGACGTTTG Chr8:129998345..129998364 59.93 45 ACTCTTGCCGTAGACGCTGT Chr8:130117016..130117035 60.08 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713048 Chr8:129588145..129588373 CATGAAAGTGACCGTGTGCT Chr8:129588253..129588272 59.75 50
upstream ENSMUSE00000716122 Chr8:129588145..129588373 CATGAAAGTGACCGTGTGCT Chr8:129588253..129588272 59.75 50
upstream ENSMUSE00000314916 Chr8:129685110..129685211 CATCCTCTGTGACGTTGCTG Chr8:129685178..129685197 60.46 55
upstream ENSMUSE00000677937 Chr8:129685110..129685211 CATCCTCTGTGACGTTGCTG Chr8:129685178..129685197 60.46 55
upstream ENSMUSE00000314907 Chr8:129800921..129801101 AATTGAGGTCACGCCTTCAG Chr8:129801070..129801089 60.26 50
upstream ENSMUSE00000677936 Chr8:129800921..129801101 AATTGAGGTCACGCCTTCAG Chr8:129801070..129801089 60.26 50
upstream ENSMUSE00000605613 Chr8:129830210..129830408 CTGGCCTTTCCACTTCTGTC Chr8:129830272..129830291 59.84 55
upstream ENSMUSE00000314897 Chr8:129830230..129830408 CTGGCCTTTCCACTTCTGTC Chr8:129830272..129830291 59.84 55
upstream ENSMUSE00000677935 Chr8:129830230..129830408 CTGGCCTTTCCACTTCTGTC Chr8:129830272..129830291 59.84 55
upstream ENSMUSE00000314887 Chr8:129847941..129848072 GATCCCAGTAGCTGGTCCAA Chr8:129847971..129847990 60.07 55
upstream ENSMUSE00000314877 Chr8:129881175..129881266 GCTGATACCGGATTGGAGAA Chr8:129881226..129881245 60.04 50
upstream ENSMUSE00000153411 Chr8:129883627..129883710 TCGTACAAGTCCCCAACGAT Chr8:129883641..129883660 60.38 50
upstream ENSMUSE00000153413 Chr8:129894148..129894273 AGTGAAGCGGTTGGAGAAAG Chr8:129894163..129894182 59.47 50
upstream ENSMUSE00000153401 Chr8:129895396..129895778 CTCATAGTGCTCACGCCTCA Chr8:129895644..129895663 60.16 55
upstream ENSMUSE00000153409 Chr8:129900644..129900783 CATTCAGGATGGCAGACTCA Chr8:129900741..129900760 59.79 50
upstream ENSMUSE00000153414 Chr8:129902086..129902214 TGAGCCTTCTGGTCTTTCGT Chr8:129902165..129902184 59.99 50
upstream ENSMUSE00000153410 Chr8:129904365..129904403 AATGCTGAACCAAGCCAGAT Chr8:129904365..129904384 59.7 45
upstream ENSMUSE00000153405 Chr8:129912410..129912598 TGTTCTCACACCCGATGGTA Chr8:129912430..129912449 59.96 50
upstream ENSMUSE00000314823 Chr8:129913228..129913398 CGGATCAGCAGATGTAACGA Chr8:129913378..129913397 59.82 50
upstream ENSMUSE00000153408 Chr8:129922500..129922650 CCCTCTACAGTGGGATCGAG Chr8:129922582..129922601 59.67 60
upstream ENSMUSE00000677932 Chr8:129924298..129925961 CCATTGGTACACCAGCTCCT Chr8:129924326..129924345 59.99 55
upstream ENSMUSE00000153402 Chr8:129929275..129929464 AACATGCCTCACGATGACAC Chr8:129929301..129929320 59.56 50
upstream ENSMUSE00000153412 Chr8:129933456..129933604 AGATGTTGATCCGGTTCTCG Chr8:129933468..129933487 60.07 50
upstream ENSMUSE00000605612 Chr8:129933456..129933607 AGATGTTGATCCGGTTCTCG Chr8:129933468..129933487 60.07 50
upstream ENSMUSE00000153415 Chr8:129934629..129934673 CAGTGGATGACCAGAGAGCA Chr8:129934653..129934672 59.98 55
upstream ENSMUSE00000153407 Chr8:129939470..129939697 CCATGGTTGATGATGACGAC Chr8:129939662..129939681 59.77 50
upstream ENSMUSE00000153406 Chr8:129950422..129950653 CAAGAAGGGGATGCTGAAAG Chr8:129950615..129950634 59.81 50
upstream ENSMUSE00000579236 Chr8:129956695..129956725 CTGAAGCCGGAGAAGAGATG Chr8:129956705..129956724 60.09 55
upstream ENSMUSE00000314792 Chr8:129984174..129984284 TGGCAAACATCGAAAAGATG Chr8:129984177..129984196 59.66 40
upstream ENSMUSE00000314786 Chr8:129998279..129998515 AGATTTCCATCGGACGTTTG Chr8:129998345..129998364 59.93 45

*** Putative Vector Insertion (Chr 8: 129998516 - 130116960) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314783 Chr8:130116961..130117081 ACTCTTGCCGTAGACGCTGT Chr8:130117016..130117035 60.08 55
downstream ENSMUSE00000314779 Chr8:130126959..130127086 ACTTGAACCTCCACGGACAC Chr8:130127020..130127039 60.01 55
downstream ENSMUSE00000605614 Chr8:130134332..130134730 TCTGTTCAGCCTAGCCACCT Chr8:130134638..130134657 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAGGTAGCTTGGTGGTCT Chr8:130079548..130079568 60.51 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAACTCATGACAAGCTTTGAA Chr8:130076484..130076507 59.91 34.78 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025812