Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6921
Trapped Gene
AL772328.13 (ENSMUSG00000078696)
Vector Insertion
Chr 4: 57383693 - 57383749
Public Clones RST456 (baygenomics) RRZ672 (baygenomics) P090E09 (ggtc) H001F05 (ggtc)
P081D09 (ggtc)
Private Clones OST329467 (lexicon) OST37626 (lexicon) OST32922 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673851 (Chr4:57383750..57384899 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTCCTACCCCCAATGTGT Chr4:57384112..57384131 60.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673851 (Chr4:57383750..57384899 -)
Downstram Exon
ENSMUSE00000673850 (Chr4:57383645..57383692 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTCCTACCCCCAATGTGT Chr4:57384112..57384131 60.09 50 GGGTGCAGCGAACTTTATTG Chr4:57383623..57383642 60.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673851 Chr4:57383750..57384899 TGTTCCTACCCCCAATGTGT Chr4:57384112..57384131 60.09 50

*** Putative Vector Insertion (Chr 4: 57383693 - 57383749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673850 Chr4:57383645..57383692 GGGTGCAGCGAACTTTATTG Chr4:57383623..57383642 60.64 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTGAGCATCTCCCTCACA Chr4:57383732..57383752 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTGAGCATCTCCCTCACA Chr4:57383732..57383752 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078696