Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6926
Trapped Gene
Taf1a (ENSMUSG00000072258)
Vector Insertion
Chr NT_165754: 371242 - 373950
Public Clones RRZ659 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000628380 (ChrNT_165754:371128..371241 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCACCCCAAAAGCAATGT ChrNT_165754:371161..371180 60.23 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000628380 (ChrNT_165754:371128..371241 +)
Downstram Exon
ENSMUSE00000679197 (ChrNT_165754:373951..374149 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCACCCCAAAAGCAATGT ChrNT_165754:371161..371180 60.23 45 AGGTTCCTGTTCGCATCATC ChrNT_165754:374018..374037 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679200 ChrNT_165754:362233..362438 AAGCGCTCGTTAACTGCTTC ChrNT_165754:362308..362327 59.8 50
upstream ENSMUSE00000628382 ChrNT_165754:364269..364392 CAGAAACGTCGGTGCTCTCT ChrNT_165754:364324..364343 60.59 55
upstream ENSMUSE00000628381 ChrNT_165754:369258..369427 TTTGCTCAGACGACAAGTGC ChrNT_165754:369284..369303 60.18 50
upstream ENSMUSE00000628380 ChrNT_165754:371128..371241 TACCACCCCAAAAGCAATGT ChrNT_165754:371161..371180 60.23 45

*** Putative Vector Insertion (Chr NT_165754: 371242 - 373950) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679197 ChrNT_165754:373951..374149 AGGTTCCTGTTCGCATCATC ChrNT_165754:374018..374037 60.08 50
downstream ENSMUSE00000679196 ChrNT_165754:375968..376098 CGGCGTAAGCGTAATCATCT ChrNT_165754:375994..376013 60.25 50
downstream ENSMUSE00000679195 ChrNT_165754:377675..377833 CGACGGGAACTTCTCATCAT ChrNT_165754:377755..377774 60.07 50
downstream ENSMUSE00000679194 ChrNT_165754:379244..379310 GGGATGGCACAATCTCATGT ChrNT_165754:379271..379290 60.76 50
downstream ENSMUSE00000679193 ChrNT_165754:379892..379983 TTTCCAGGCCGTTATGTTCT ChrNT_165754:379983..380002 59.57 45
downstream ENSMUSE00000679192 ChrNT_165754:381764..381780 No primer for this exon
downstream ENSMUSE00000679191 ChrNT_165754:381915..381929 No primer for this exon
downstream ENSMUSE00000679190 ChrNT_165754:381957..382111 CACTCTTCGCCCAAAAGAAG ChrNT_165754:382048..382067 59.99 50
downstream ENSMUSE00000679189 ChrNT_165754:382583..382701 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT ChrNT_165754:371292..371312 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTGACCGGATGAAAAATA ChrNT_165754:371200..371220 60.96 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072258