Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6996
Trapped Gene
Nup214 (ENSMUSG00000001855)
Vector Insertion
Chr 2: 31875878 - 31880762
Public Clones RRZ232 (baygenomics) IST10668H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000163374 (Chr2:31875778..31875877 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000163374 (Chr2:31875778..31875877 +)
Downstram Exon
ENSMUSE00000163398 (Chr2:31880763..31880838 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422239 Chr2:31829970..31830128 No primer for this exon
upstream ENSMUSE00000422234 Chr2:31832020..31832215 No primer for this exon
upstream ENSMUSE00000422232 Chr2:31833284..31833435 No primer for this exon
upstream ENSMUSE00000422227 Chr2:31835210..31835408 No primer for this exon
upstream ENSMUSE00000422224 Chr2:31836030..31836100 No primer for this exon
upstream ENSMUSE00000422221 Chr2:31838131..31838194 No primer for this exon
upstream ENSMUSE00000422219 Chr2:31838643..31838746 No primer for this exon
upstream ENSMUSE00000422217 Chr2:31843674..31843780 No primer for this exon
upstream ENSMUSE00000422212 Chr2:31844593..31844659 No primer for this exon
upstream ENSMUSE00000422210 Chr2:31845755..31845881 No primer for this exon
upstream ENSMUSE00000422208 Chr2:31846784..31846945 No primer for this exon
upstream ENSMUSE00000422204 Chr2:31850043..31850496 No primer for this exon
upstream ENSMUSE00000278458 Chr2:31851896..31852071 No primer for this exon
upstream ENSMUSE00000163408 Chr2:31853473..31853570 No primer for this exon
upstream ENSMUSE00000163382 Chr2:31858112..31858198 No primer for this exon
upstream ENSMUSE00000163394 Chr2:31858401..31858550 No primer for this exon
upstream ENSMUSE00000163390 Chr2:31859833..31859991 No primer for this exon
upstream ENSMUSE00000163401 Chr2:31862209..31862312 No primer for this exon
upstream ENSMUSE00000278412 Chr2:31865703..31865885 No primer for this exon
upstream ENSMUSE00000163378 Chr2:31866532..31866605 No primer for this exon
upstream ENSMUSE00000163389 Chr2:31866705..31866788 No primer for this exon
upstream ENSMUSE00000163388 Chr2:31872546..31872857 No primer for this exon
upstream ENSMUSE00000163380 Chr2:31873715..31873876 No primer for this exon
upstream ENSMUSE00000163374 Chr2:31875778..31875877 No primer for this exon

*** Putative Vector Insertion (Chr 2: 31875878 - 31880762) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000163398 Chr2:31880763..31880838 No primer for this exon
downstream ENSMUSE00000163391 Chr2:31882368..31882446 No primer for this exon
downstream ENSMUSE00000278336 Chr2:31886227..31886317 No primer for this exon
downstream ENSMUSE00000278327 Chr2:31886770..31886828 No primer for this exon
downstream ENSMUSE00000278319 Chr2:31888723..31890489 No primer for this exon
downstream ENSMUSE00000163400 Chr2:31893622..31893692 No primer for this exon
downstream ENSMUSE00000403401 Chr2:31894843..31894996 No primer for this exon
downstream ENSMUSE00000163404 Chr2:31897937..31898089 No primer for this exon
downstream ENSMUSE00000163402 Chr2:31902923..31903094 No primer for this exon
downstream ENSMUSE00000163385 Chr2:31906529..31906668 No primer for this exon
downstream ENSMUSE00000163383 Chr2:31907294..31907318 No primer for this exon
downstream ENSMUSE00000514758 Chr2:31907639..31909495 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCCTACGCAGTCCTTTGC Chr2:31875869..31875889 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCCTACGCAGTCCTTTGC Chr2:31875869..31875889 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001855