Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7000
Trapped Gene
Nle1 (ENSMUSG00000020692)
Vector Insertion
Chr 11: 82718487 - 82718779
Public Clones RRZ243 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108054 (Chr11:82718780..82718877 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108054 (Chr11:82718780..82718877 -)
Downstram Exon
ENSMUSE00000108051 (Chr11:82718294..82718486 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000649706 Chr11:82721841..82721873 No primer for this exon
upstream ENSMUSE00000279700 Chr11:82721594..82721737 No primer for this exon
upstream ENSMUSE00000279693 Chr11:82721055..82721272 No primer for this exon
upstream ENSMUSE00000108046 Chr11:82719927..82720006 No primer for this exon
upstream ENSMUSE00000108053 Chr11:82719009..82719085 No primer for this exon
upstream ENSMUSE00000108054 Chr11:82718780..82718877 No primer for this exon

*** Putative Vector Insertion (Chr 11: 82718487 - 82718779) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108051 Chr11:82718294..82718486 No primer for this exon
downstream ENSMUSE00000366794 Chr11:82717742..82717877 No primer for this exon
downstream ENSMUSE00000279658 Chr11:82717592..82717638 No primer for this exon
downstream ENSMUSE00000412361 Chr11:82716497..82716699 No primer for this exon
downstream ENSMUSE00000108044 Chr11:82715211..82715370 No primer for this exon
downstream ENSMUSE00000661604 Chr11:82715059..82715129 No primer for this exon
downstream ENSMUSE00000661603 Chr11:82714273..82714552 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAACGCTGCCCCTCCTAAT Chr11:82718724..82718744 60.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000020692