Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7003
Trapped Gene
BC052040 (ENSMUSG00000040282)
Vector Insertion
Chr 2: 115407722 - 115456740
Public Clones RRZ260 (baygenomics)
Private Clones OST353100 (lexicon) OST118477 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435687 (Chr2:115407512..115407721 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGCCCTTCCCTAGGTTC Chr2:115407551..115407570 60.2 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435687 (Chr2:115407512..115407721 +)
Downstram Exon
ENSMUSE00000435652 (Chr2:115456741..115456786 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGCCCTTCCCTAGGTTC Chr2:115407551..115407570 60.2 60 TCCTGGGAGAAGATGCTCAG Chr2:115456782..115456801 60.49 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435687 Chr2:115407512..115407721 CTCTGCCCTTCCCTAGGTTC Chr2:115407551..115407570 60.2 60

*** Putative Vector Insertion (Chr 2: 115407722 - 115456740) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435652 Chr2:115456741..115456786 TCCTGGGAGAAGATGCTCAG Chr2:115456782..115456801 60.49 55
downstream ENSMUSE00000435646 Chr2:115457672..115457736 TCAATCGCTTCTGGAGTGTG Chr2:115457724..115457743 59.98 50
downstream ENSMUSE00000435640 Chr2:115464740..115464800 No primer for this exon
downstream ENSMUSE00000296980 Chr2:115468400..115468472 GAGTCTGTTCATGCCCCTGT Chr2:115468472..115468491 60.12 55
downstream ENSMUSE00000296970 Chr2:115495318..115495397 GTCCCGCAGCATACTGTTTA Chr2:115495355..115495374 58.8 50
downstream ENSMUSE00000296963 Chr2:115495745..115495794 AGCGGTCCATAGCAACAGTC Chr2:115495779..115495798 60.28 55
downstream ENSMUSE00000296958 Chr2:115500462..115500529 CAGGACTTCATGCTCATAGCC Chr2:115500491..115500511 59.85 52.38
downstream ENSMUSE00000296953 Chr2:115512121..115512186 TGAAGTCTGGGGTTTTGTCA Chr2:115512171..115512190 59.11 45
downstream ENSMUSE00000296948 Chr2:115512800..115512905 GTAGGCGTGGTGGCTACATT Chr2:115512876..115512895 60.02 55
downstream ENSMUSE00000685896 Chr2:115602638..115604504 AGGTTATTCCCCGGTAATGC Chr2:115603278..115603297 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCATCCATATCCAACATTGC Chr2:115422728..115422749 60.55 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGTGACTGGGAAAACC Chr2:115422769..115422789 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040282