Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI702
Trapped Gene
Vapb (ENSMUSG00000054455)
Vector Insertion
Chr 2: 173563252 - 173587617
Public Clones DB0226 (sanger) (sanger) XC300 (baygenomics) XD084 (baygenomics) Ayu21-T290 (egtc)
IST12846D4 (tigm)
Private Clones OST422455 (lexicon) OST119294 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000349103 (Chr2:173563083..173563251 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGTGGAACAGGTCCTGAG Chr2:173563200..173563219 59.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000349103 (Chr2:173563083..173563251 +)
Downstram Exon
ENSMUSE00000548835 (Chr2:173587618..173587770 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGTGGAACAGGTCCTGAG Chr2:173563200..173563219 59.15 55 CACACATTTCGGTCTGTTGG Chr2:173587684..173587703 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349103 Chr2:173563083..173563251 AAGGTGGAACAGGTCCTGAG Chr2:173563200..173563219 59.15 55

*** Putative Vector Insertion (Chr 2: 173563252 - 173587617) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000548835 Chr2:173587618..173587770 CACACATTTCGGTCTGTTGG Chr2:173587684..173587703 60 50
downstream ENSMUSE00000170240 Chr2:173597022..173597125 GGCGGAGCAAACATAGACTG Chr2:173597103..173597122 60.8 55
downstream ENSMUSE00000170243 Chr2:173599895..173599975 TCTGCTGGCAATTCAAACAC Chr2:173599965..173599984 59.85 45
downstream ENSMUSE00000170242 Chr2:173601613..173601789 TTCTGTCTTGGATGCACTCG Chr2:173601666..173601685 59.98 50
downstream ENSMUSE00000446334 Chr2:173603564..173604849 GTCCTACGGCAACAGACCAT Chr2:173603968..173603987 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACGAGAGACCCAGCAAGT Chr2:173563273..173563293 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGACGTGACTGGGAAAA Chr2:173563297..173563317 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054455