Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7037
Trapped Gene
Alkbh8 (ENSMUSG00000025899)
Vector Insertion
Chr 9: 3359591 - 3367863
Public Clones RRY122 (baygenomics) IST13651A2 (tigm) IST11553H10 (tigm) IST14143B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457027 (Chr9:3359484..3359590 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTACCTCGTCGGAGTTTGCT Chr9:3359532..3359551 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457027 (Chr9:3359484..3359590 +)
Downstram Exon
ENSMUSE00000457025 (Chr9:3367864..3368015 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTACCTCGTCGGAGTTTGCT Chr9:3359532..3359551 59.88 50 CTCAGACGCTTGGACGGTAT Chr9:3367906..3367925 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000384764 Chr9:3335478..3335594 CAGCTGGGAGGTGAACATTT Chr9:3335572..3335591 60.11 50
upstream ENSMUSE00000153944 Chr9:3338456..3338591 AAGGCATCCAAGCAGTGTCT Chr9:3338560..3338579 59.87 50
upstream ENSMUSE00000153943 Chr9:3343015..3343252 GTCTGGGTAATGGCGTGAGT Chr9:3343037..3343056 60 55
upstream ENSMUSE00000457045 Chr9:3344588..3344719 CAGGCCTCTTGGTGGTAGAA Chr9:3344624..3344643 60.25 55
upstream ENSMUSE00000457040 Chr9:3345781..3345876 No primer for this exon
upstream ENSMUSE00000457035 Chr9:3347804..3347908 TCCTGAGGTTTGCAGTAGCA Chr9:3347808..3347827 59.59 50
upstream ENSMUSE00000457033 Chr9:3349420..3349490 ATTGACACGCATTCTGCATT Chr9:3349434..3349453 59.16 40
upstream ENSMUSE00000457027 Chr9:3359484..3359590 TTACCTCGTCGGAGTTTGCT Chr9:3359532..3359551 59.88 50

*** Putative Vector Insertion (Chr 9: 3359591 - 3367863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457025 Chr9:3367864..3368015 CTCAGACGCTTGGACGGTAT Chr9:3367906..3367925 60.28 55
downstream ENSMUSE00000153963 Chr9:3369658..3369914 TTGTCTGTCGCAGACTGAGG Chr9:3369686..3369705 60.18 55
downstream ENSMUSE00000340659 Chr9:3382694..3382843 TGGTGAATGACGGCAATAGA Chr9:3382833..3382852 60.07 45
downstream ENSMUSE00000378203 Chr9:3385042..3387050 TGTTCCATTGCCCAGACATA Chr9:3385130..3385149 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTTTGCTGGTGATGACA Chr9:3365543..3365563 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTTTGCTGGTGATGACA Chr9:3365543..3365563 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025899