Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7038
Trapped Gene
Vmn2r-ps105 (ENSMUSG00000074834)
Vector Insertion
Chr 13: 66481901 - 66502701
Public Clones RRY100 (baygenomics) IST15100A8 (tigm) IST10899D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681436 (Chr13:66502702..66502809 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGAGGGGACCTCAGGAAG Chr13:66502720..66502739 60.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681436 (Chr13:66502702..66502809 -)
Downstram Exon
ENSMUSE00000681434 (Chr13:66481714..66481900 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGAGGGGACCTCAGGAAG Chr13:66502720..66502739 60.45 55 GGTGGACTGTCCCACTGTTT Chr13:66481729..66481748 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681436 Chr13:66502702..66502809 ATTGAGGGGACCTCAGGAAG Chr13:66502720..66502739 60.45 55

*** Putative Vector Insertion (Chr 13: 66481901 - 66502701) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681434 Chr13:66481714..66481900 GGTGGACTGTCCCACTGTTT Chr13:66481729..66481748 59.86 55
downstream ENSMUSE00000681433 Chr13:66472277..66472419 CCCAGTATAGGGCGATGCTA Chr13:66472365..66472384 60.07 55
downstream ENSMUSE00000681431 Chr13:66471146..66471268 TCAGGTTGTGAGCTGAATGG Chr13:66471158..66471177 59.83 50
downstream ENSMUSE00000681430 Chr13:66463142..66463219 ACATGTCCAATGCCCTGAGT Chr13:66463171..66463190 60.4 50
downstream ENSMUSE00000681429 Chr13:66457558..66457699 TTTATCCTCACACAGGCCATC Chr13:66457548..66457568 59.95 47.62
downstream ENSMUSE00000641377 Chr13:66456251..66456347 TGTGGTGTGCAAAAGTGACA Chr13:66456232..66456251 59.75 45
downstream ENSMUSE00000641376 Chr13:66455931..66456102 AATGCTGTCCATTCCGATGT Chr13:66456060..66456079 60.35 45
downstream ENSMUSE00000641375 Chr13:66454699..66454923 AAATACCTGGGCTTTCAGCA Chr13:66454872..66454891 59.71 45
downstream ENSMUSE00000681424 Chr13:66451855..66453608 TCATTGTTGGTGCCAGTTGT Chr13:66452639..66452658 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTGTGGTTAGGAACGGACA Chr13:66487707..66487728 60.38 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGGGCAAAATCAGTCTC Chr13:66487679..66487699 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATCCTTTAATCGCCTTGCAG Chr13:66487745..66487765 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTTCGTGACTGGGAAAACC Chr13:66481743..66481763 61.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074834