Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7044
Trapped Gene
Sh3glb1 (ENSMUSG00000037062)
Vector Insertion
Chr 3: 144355093 - 144359817
Public Clones RRY115 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229023 (Chr3:144359818..144359918 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCTCCGCTGTCTGAATGA Chr3:144359893..144359912 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229023 (Chr3:144359818..144359918 -)
Downstram Exon
ENSMUSE00000229018 (Chr3:144354864..144355092 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCTCCGCTGTCTGAATGA Chr3:144359893..144359912 59.94 50 GAGGACCCTAGCCTTCCTGT Chr3:144354893..144354912 59.7 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445387 Chr3:144382946..144383110 TGGATTTCAACGTGAAGAAGC Chr3:144382987..144383007 60.24 42.86
upstream ENSMUSE00000229060 Chr3:144375551..144375692 AATGAAGCAGACCGAAGTGC Chr3:144375569..144375588 60.41 50
upstream ENSMUSE00000229053 Chr3:144372197..144372325 AAACAACCCGGAACTTTTGG Chr3:144372248..144372267 61.1 45
upstream ENSMUSE00000229044 Chr3:144369562..144369695 CACAGAAGCGAATTGGAACA Chr3:144369649..144369668 59.84 45
upstream ENSMUSE00000229034 Chr3:144368477..144368569 TTGGATGCTGCAAAAACAAG Chr3:144368514..144368533 59.85 40
upstream ENSMUSE00000669027 Chr3:144364772..144364810 CGCCCTGAAGGAGATAACAT Chr3:144364776..144364795 59.15 50
upstream ENSMUSE00000669026 Chr3:144362818..144362841 ATTTGGGCAGAGGAAGTGAC Chr3:144362822..144362841 59.14 50
upstream ENSMUSE00000229027 Chr3:144360342..144360431 TCGTCAGGCAGAGATTACCC Chr3:144360374..144360393 60.22 55
upstream ENSMUSE00000229023 Chr3:144359818..144359918 CATCTCCGCTGTCTGAATGA Chr3:144359893..144359912 59.94 50

*** Putative Vector Insertion (Chr 3: 144355093 - 144359817) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000229018 Chr3:144354864..144355092 GAGGACCCTAGCCTTCCTGT Chr3:144354893..144354912 59.7 60
downstream ENSMUSE00000229010 Chr3:144354032..144354496 TCCATTCCAACGACACTGAA Chr3:144354443..144354462 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:144356747..144356767 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATAGGCTCAGCGTGACTGG Chr3:144356757..144356777 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037062