Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7049
Trapped Gene
Med1 (ENSMUSG00000018160)
Vector Insertion
Chr 11: 98033085 - 98034534
Public Clones RRY061 (baygenomics)
Private Clones OST423084 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111333 (Chr11:98034535..98034606 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111333 (Chr11:98034535..98034606 -)
Downstram Exon
ENSMUSE00000111340 (Chr11:98033010..98033084 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710213 Chr11:98054373..98054607 No primer for this exon
upstream ENSMUSE00000717823 Chr11:98054373..98054607 No primer for this exon
upstream ENSMUSE00000436397 Chr11:98054121..98054220 No primer for this exon
upstream ENSMUSE00000509406 Chr11:98050496..98050602 No primer for this exon
upstream ENSMUSE00000673585 Chr11:98050496..98050602 No primer for this exon
upstream ENSMUSE00000283153 Chr11:98045156..98045234 No primer for this exon
upstream ENSMUSE00000283146 Chr11:98041568..98041622 No primer for this exon
upstream ENSMUSE00000111349 Chr11:98041331..98041463 No primer for this exon
upstream ENSMUSE00000111344 Chr11:98040426..98040454 No primer for this exon
upstream ENSMUSE00000111333 Chr11:98034535..98034606 No primer for this exon

*** Putative Vector Insertion (Chr 11: 98033085 - 98034534) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111340 Chr11:98033010..98033084 No primer for this exon
downstream ENSMUSE00000283118 Chr11:98032262..98032335 No primer for this exon
downstream ENSMUSE00000111336 Chr11:98030677..98030766 No primer for this exon
downstream ENSMUSE00000111342 Chr11:98028833..98028944 No primer for this exon
downstream ENSMUSE00000111346 Chr11:98028013..98028137 No primer for this exon
downstream ENSMUSE00000111338 Chr11:98027570..98027688 No primer for this exon
downstream ENSMUSE00000111335 Chr11:98025114..98025315 No primer for this exon
downstream ENSMUSE00000436322 Chr11:98022458..98022553 No primer for this exon
downstream ENSMUSE00000464550 Chr11:98022251..98022356 No primer for this exon
downstream ENSMUSE00000283052 Chr11:98019643..98019783 No primer for this exon
downstream ENSMUSE00000673539 Chr11:98016555..98019783 No primer for this exon
downstream ENSMUSE00000503230 Chr11:98014975..98019783 No primer for this exon
downstream ENSMUSE00000577509 Chr11:98014028..98014277 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCCCAGGGGACAAGTAAG Chr11:98034528..98034548 59.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCCCAGGGGACAAGTAAG Chr11:98034528..98034548 59.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018160