Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7051
Trapped Gene
Osbpl9 (ENSMUSG00000028559)
Vector Insertion
Chr 4: 108745755 - 108755693
Public Clones RRY059 (baygenomics) D139A07 (ggtc) D139A07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268278 (Chr4:108755694..108755853 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAACTCACCACCTAGCAG Chr4:108755829..108755848 59.72 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268278 (Chr4:108755694..108755853 -)
Downstram Exon
ENSMUSE00000268271 (Chr4:108745642..108745754 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAACTCACCACCTAGCAG Chr4:108755829..108755848 59.72 60 CTGTGGTATCTGGGCGTTTT Chr4:108745662..108745681 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708618 Chr4:108874710..108874821 GGATGGCAGTATCGTTGGTT Chr4:108874750..108874769 59.82 50
upstream ENSMUSE00000721663 Chr4:108874710..108874821 AAGGGATGGCAGTATCGTTG Chr4:108874753..108874772 59.96 50
upstream ENSMUSE00000525621 Chr4:108844879..108844929 TCTCGAAGAGGATGCGTTAGA Chr4:108844885..108844905 60.1 47.62
upstream ENSMUSE00000670726 Chr4:108844879..108844929 TCTCGAAGAGGATGCGTTAGA Chr4:108844885..108844905 60.1 47.62
upstream ENSMUSE00000670704 Chr4:108834895..108834981 AGAGGGTCCTGGCTGTTGTT Chr4:108834950..108834969 61.08 55
upstream ENSMUSE00000525620 Chr4:108829260..108829338 GAGGACGACAGCACCTTCAC Chr4:108829295..108829314 60.87 60
upstream ENSMUSE00000670725 Chr4:108829260..108829338 GAGGACGACAGCACCTTCAC Chr4:108829295..108829314 60.87 60
upstream ENSMUSE00000525619 Chr4:108806349..108806425 AGACGAGCGAGAGAAGTGGA Chr4:108806396..108806415 60.28 55
upstream ENSMUSE00000715843 Chr4:108806349..108806425 AGACGAGCGAGAGAAGTGGA Chr4:108806396..108806415 60.28 55
upstream ENSMUSE00000718566 Chr4:108806349..108806425 AGACGAGCGAGAGAAGTGGA Chr4:108806396..108806415 60.28 55
upstream ENSMUSE00000631530 Chr4:108790500..108790526 No primer for this exon
upstream ENSMUSE00000601321 Chr4:108775102..108775197 GAAACTTACCGAGGCTGACG Chr4:108775134..108775153 59.88 55
upstream ENSMUSE00000601326 Chr4:108775102..108775197 GAAACTTACCGAGGCTGACG Chr4:108775134..108775153 59.88 55
upstream ENSMUSE00000601320 Chr4:108773721..108773768 No primer for this exon
upstream ENSMUSE00000601325 Chr4:108773721..108773768 No primer for this exon
upstream ENSMUSE00000670701 Chr4:108772534..108772555 No primer for this exon
upstream ENSMUSE00000601319 Chr4:108772526..108772555 No primer for this exon
upstream ENSMUSE00000601324 Chr4:108772526..108772555 No primer for this exon
upstream ENSMUSE00000601318 Chr4:108771108..108771158 No primer for this exon
upstream ENSMUSE00000601323 Chr4:108771108..108771158 No primer for this exon
upstream ENSMUSE00000383258 Chr4:108764266..108764304 GACCAGAGTAATGCGGAGCA Chr4:108764285..108764304 61.35 55
upstream ENSMUSE00000351821 Chr4:108760000..108760090 TACCAGCCTAGTCCCTTGGA Chr4:108760044..108760063 59.69 55
upstream ENSMUSE00000268287 Chr4:108758932..108759036 GCAGCGTCCATCTTCCTTAC Chr4:108758992..108759011 59.84 55
upstream ENSMUSE00000268278 Chr4:108755694..108755853 GGGAACTCACCACCTAGCAG Chr4:108755829..108755848 59.72 60

*** Putative Vector Insertion (Chr 4: 108745755 - 108755693) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268271 Chr4:108745642..108745754 CTGTGGTATCTGGGCGTTTT Chr4:108745662..108745681 59.99 50
downstream ENSMUSE00000268264 Chr4:108745419..108745537 GGTGCATGATAACGCTCTTG Chr4:108745435..108745454 59.3 50
downstream ENSMUSE00000268257 Chr4:108744548..108744633 TGGATGTGCGAAAAAGTCTG Chr4:108744540..108744559 59.84 45
downstream ENSMUSE00000268251 Chr4:108740968..108741139 TTCAGTATCATTCGGCAACG Chr4:108740955..108740974 59.69 45
downstream ENSMUSE00000268244 Chr4:108739520..108739604 ATGGTGGGAAACTTGCTCAG Chr4:108739505..108739524 60.11 50
downstream ENSMUSE00000268234 Chr4:108738733..108738843 CCAATTGACATCCCAAGGAA Chr4:108738731..108738750 60.69 45
downstream ENSMUSE00000268226 Chr4:108738470..108738533 TGGGGAACGTGAGGATGTAG Chr4:108738461..108738480 60.91 55
downstream ENSMUSE00000268218 Chr4:108738229..108738369 TAACCCGTTTTGGAGCAGTT Chr4:108738279..108738298 59.61 45
downstream ENSMUSE00000268213 Chr4:108737168..108737246 CCCTGTTGCGTATTTTGCAT Chr4:108737146..108737165 60.89 45
downstream ENSMUSE00000180151 Chr4:108735971..108736062 CTGCGGGACTCATACTCATTC Chr4:108735949..108735969 59.71 52.38
downstream ENSMUSE00000180152 Chr4:108735070..108735205 TCGTCTCCCACTGAATTTCC Chr4:108735050..108735069 60.05 50
downstream ENSMUSE00000525618 Chr4:108734260..108734937 ATTTTATGCCCGAACAGCAG Chr4:108734507..108734526 60.1 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCATCAAAGTGGCTCGTC Chr4:108749710..108749730 61.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTCGTGACTGGGAAAACC Chr4:108749626..108749646 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGGTCAGGCTGGAGAAGTC Chr4:108749874..108749894 60.79 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATGTCGTGACTGGGAAAACC Chr4:108749787..108749807 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028559