Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7060
Trapped Gene
Ewsr1 (ENSMUSG00000009079)
Vector Insertion
Chr 11: 4993909 - 4999011
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
RRY446 (baygenomics) RRY454 (baygenomics) W117A08 (ggtc) W117B08 (ggtc)
P093F05 (ggtc) D046A05 (ggtc) D021E11 (ggtc) (ggtc) P062B05 (ggtc)
M066D01 (ggtc) E085G08 (ggtc) D043G03 (ggtc) D005F03 (ggtc) (ggtc)
(ggtc) D048D02 (ggtc) P028D06 (ggtc) P097E06 (ggtc) D133G12 (ggtc)
D038A05 (ggtc) (ggtc) P066F09 (ggtc) P015D02 (ggtc) E089G08 (ggtc)
D045D02 (ggtc) D021E11 (ggtc) (ggtc) P062C02 (ggtc) P107A03 (ggtc)
D133H05 (ggtc) D038A06 (ggtc) (ggtc) P097E06 (ggtc) W117C08 (ggtc)
P097E06 (ggtc) D046A05 (ggtc) D022H06 (ggtc) (ggtc) P065D07 (ggtc)
W251A07 (ggtc) E089G08 (ggtc) D045D02 (ggtc) D021C09 (ggtc) (ggtc)
D038A05 (ggtc) P093F05 (ggtc) P107A03 (ggtc) D133G12 (ggtc) D038A05 (ggtc)
(ggtc) IST13412D2 (tigm) IST10932C9 (tigm) IST14562H10 (tigm) IST10912C7 (tigm)
IST10900A5 (tigm) IST14406D5 (tigm) IST14923H5 (tigm)
Private Clones OST202740 (lexicon) OST55121 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000455024 (Chr11:4999012..4999080 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000455024 (Chr11:4999012..4999080 -)
Downstram Exon
ENSMUSE00000656024 (Chr11:4993872..4993908 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455024 Chr11:4999012..4999080 No primer for this exon
upstream ENSMUSE00000660793 Chr11:4999012..4999099 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4993909 - 4999011) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656024 Chr11:4993872..4993908 No primer for this exon
downstream ENSMUSE00000656023 Chr11:4993684..4993735 No primer for this exon
downstream ENSMUSE00000656022 Chr11:4991862..4991985 No primer for this exon
downstream ENSMUSE00000581344 Chr11:4991463..4991480 No primer for this exon
downstream ENSMUSE00000681956 Chr11:4990462..4991480 No primer for this exon
downstream ENSMUSE00000656021 Chr11:4987963..4988149 No primer for this exon
downstream ENSMUSE00000656020 Chr11:4985899..4986066 No primer for this exon
downstream ENSMUSE00000656019 Chr11:4983363..4983574 No primer for this exon
downstream ENSMUSE00000581349 Chr11:4982287..4982436 No primer for this exon
downstream ENSMUSE00000306116 Chr11:4982256..4982436 No primer for this exon
downstream ENSMUSE00000581345 Chr11:4980601..4980691 No primer for this exon
downstream ENSMUSE00000306110 Chr11:4979488..4979522 No primer for this exon
downstream ENSMUSE00000306105 Chr11:4978923..4978955 No primer for this exon
downstream ENSMUSE00000331745 Chr11:4978476..4978594 No primer for this exon
downstream ENSMUSE00000581348 Chr11:4978476..4978582 No primer for this exon
downstream ENSMUSE00000656018 Chr11:4972815..4972944 No primer for this exon
downstream ENSMUSE00000656017 Chr11:4971523..4971645 No primer for this exon
downstream ENSMUSE00000656016 Chr11:4970999..4971161 No primer for this exon
downstream ENSMUSE00000656014 Chr11:4970629..4970726 No primer for this exon
downstream ENSMUSE00000656013 Chr11:4970231..4970483 No primer for this exon
downstream ENSMUSE00000660792 Chr11:4969691..4970106 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTAGGGGATTGTGAAGCAG Chr11:4996004..4996024 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTAGGGGATTGTGAAGCAG Chr11:4996004..4996024 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATAATCGCCTTGCAGCACA Chr11:4996012..4996032 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAGGAGACGGACGTTGAGA Chr11:4996045..4996065 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009079