Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7106
Trapped Gene
Tjap1 (ENSMUSG00000012296)
Vector Insertion
Chr 17: 46401928 - 46419294
Public Clones YTC803 (baygenomics) RRJ368 (baygenomics) D106H07 (ggtc) D137A08 (ggtc)
D015E06 (ggtc) D106H07 (ggtc) D015E06 (ggtc) PST7408-NR (escells) PST6814-NR (escells)
IST14251E2 (tigm) IST10442F7 (tigm) IST14640A12 (tigm) IST14915C9 (tigm)
IST14808A7 (tigm)
Private Clones OST347652 (lexicon) OST257851 (lexicon) OST176619 (lexicon) OST43734 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222842 (Chr17:46419295..46419388 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222842 (Chr17:46419295..46419388 -)
Downstram Exon
ENSMUSE00000136622 (Chr17:46401832..46401927 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398694 Chr17:46419909..46419948 No primer for this exon
upstream ENSMUSE00000222842 Chr17:46419295..46419388 No primer for this exon

*** Putative Vector Insertion (Chr 17: 46401928 - 46419294) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136622 Chr17:46401832..46401927 No primer for this exon
downstream ENSMUSE00000136626 Chr17:46400638..46400762 No primer for this exon
downstream ENSMUSE00000136629 Chr17:46399351..46399379 No primer for this exon
downstream ENSMUSE00000136624 Chr17:46398368..46398529 No primer for this exon
downstream ENSMUSE00000136628 Chr17:46398085..46398151 No primer for this exon
downstream ENSMUSE00000136625 Chr17:46397044..46397151 No primer for this exon
downstream ENSMUSE00000136627 Chr17:46396886..46396969 No primer for this exon
downstream ENSMUSE00000136623 Chr17:46394826..46396432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGATGCAGTGCCACCTTTT Chr17:46416283..46416303 59.74 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGATGCAGTGCCACCTTTT Chr17:46416283..46416303 59.74 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAGGGACTGGAAGAAATCA Chr17:46407349..46407369 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAGGGACTGGAAGAAATCA Chr17:46407349..46407369 60.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000012296