Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7110
Trapped Gene
Bcar1 (ENSMUSG00000031955)
Vector Insertion
Chr 8: 114239677 - 114244598
Public Clones RRJ405 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000423144 (Chr8:114244599..114245231 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTAACCGCCTCAAGATTC Chr8:114245057..114245076 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000423144 (Chr8:114244599..114245231 -)
Downstram Exon
ENSMUSE00000214942 (Chr8:114239515..114239676 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTAACCGCCTCAAGATTC Chr8:114245057..114245076 60.07 50 CCTGGCCATACTGGTTAGGA Chr8:114239495..114239514 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679154 Chr8:114246997..114247008 No primer for this exon
upstream ENSMUSE00000634293 Chr8:114245273..114245281 No primer for this exon
upstream ENSMUSE00000423144 Chr8:114244599..114245231 TGGTAACCGCCTCAAGATTC Chr8:114245057..114245076 60.07 50

*** Putative Vector Insertion (Chr 8: 114239677 - 114244598) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214942 Chr8:114239515..114239676 CCTGGCCATACTGGTTAGGA Chr8:114239495..114239514 59.95 55
downstream ENSMUSE00000214941 Chr8:114239183..114239299 ACACTAGGGGGCACGTCATA Chr8:114239195..114239214 60.4 55
downstream ENSMUSE00000214936 Chr8:114237239..114238336 GCTTTGGTCCGTCTGAAAAG Chr8:114237398..114237417 59.85 50
downstream ENSMUSE00000214938 Chr8:114236501..114236590 CGCATGATGTTACCCCTTTC Chr8:114236510..114236529 60.33 50
downstream ENSMUSE00000214937 Chr8:114234385..114235294 ATTGGACGAGACACCTCCTG Chr8:114235229..114235248 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAAGGCCAACCTGGTAGA Chr8:114241578..114241599 60.01 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTAAGGCCAACCTGGTAGA Chr8:114241578..114241599 60.01 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031955