Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7117
Trapped Gene
Tbc1d1 (ENSMUSG00000029174)
Vector Insertion
Chr 5: 64730971 - 64736490
Public Clones RRJ449 (baygenomics)
Private Clones OST406579 (lexicon) OST365228 (lexicon) OST323625 (lexicon) OST323621 (lexicon)
OST323617 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186562 (Chr5:64730801..64730970 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCCATAAGCCCTTGATT Chr5:64730858..64730877 60.42 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186562 (Chr5:64730801..64730970 +)
Downstram Exon
ENSMUSE00000186575 (Chr5:64736491..64736664 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCCATAAGCCCTTGATT Chr5:64730858..64730877 60.42 50 GAGCACGTGGTACTCGACCT Chr5:64736553..64736572 60.33 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720959 Chr5:64551060..64551094 No primer for this exon
upstream ENSMUSE00000521252 Chr5:64551450..64551744 GTCTCTTCAACCCGCAAGAG Chr5:64551561..64551580 59.99 55
upstream ENSMUSE00000717142 Chr5:64551499..64551744 GTCTCTTCAACCCGCAAGAG Chr5:64551561..64551580 59.99 55
upstream ENSMUSE00000370765 Chr5:64564627..64565135 GCCGAGGTACGAAGACTCAG Chr5:64564851..64564870 60.01 60
upstream ENSMUSE00000718835 Chr5:64564627..64565135 GCCGAGGTACGAAGACTCAG Chr5:64564851..64564870 60.01 60
upstream ENSMUSE00000716231 Chr5:64621538..64621769 CGATGTCACCATTGTTCAGC Chr5:64621738..64621757 60.12 50
upstream ENSMUSE00000257576 Chr5:64647954..64648394 GACGATACCTTCGCCAAAAA Chr5:64648032..64648051 60.07 45
upstream ENSMUSE00000257571 Chr5:64651592..64651681 CCTCATCAGTCCTGACACCA Chr5:64651612..64651631 59.66 55
upstream ENSMUSE00000257564 Chr5:64654708..64654818 ATTCATCTGCCGAGAGTGCT Chr5:64654734..64654753 59.98 50
upstream ENSMUSE00000186599 Chr5:64655565..64655697 CACAAGCTCTGCGAAAGGAT Chr5:64655673..64655692 60.54 50
upstream ENSMUSE00000186568 Chr5:64662329..64662420 CACTGACCAATCAGGAGCAG Chr5:64662377..64662396 59.42 55
upstream ENSMUSE00000186581 Chr5:64666634..64666744 AAGAAACGAGCAGCGAGAGA Chr5:64666645..64666664 60.42 50
upstream ENSMUSE00000186566 Chr5:64669155..64669283 ACACTACAGGTGGCAGCAGA Chr5:64669155..64669174 59.49 55
upstream ENSMUSE00000186577 Chr5:64670570..64670656 GGATCTGGACAGCTCCACTT Chr5:64670611..64670630 59.26 55
upstream ENSMUSE00000186578 Chr5:64673004..64673284 AACTCATGCGGTACCACTCC Chr5:64673236..64673255 60 55
upstream ENSMUSE00000420812 Chr5:64675206..64675364 CACAATTCCAGTGGAGAGCA Chr5:64675321..64675340 59.83 50
upstream ENSMUSE00000420801 Chr5:64675929..64676048 CTGGCTCCCGTAGATGAAAA Chr5:64675999..64676018 60.21 50
upstream ENSMUSE00000186592 Chr5:64677184..64677323 GACTCCCCGAGCAGATATGA Chr5:64677302..64677321 60.18 55
upstream ENSMUSE00000333244 Chr5:64702298..64702483 CCCTTTAGAACCGGTGTGTG Chr5:64702332..64702351 60.4 55
upstream ENSMUSE00000421024 Chr5:64707593..64707754 AAAGTGCACTCAGCTGTTGG Chr5:64707730..64707749 59.09 50
upstream ENSMUSE00000186563 Chr5:64715690..64715848 ATCACCGAGGTGAGATCTGG Chr5:64715702..64715721 60.07 55
upstream ENSMUSE00000257611 Chr5:64724586..64724830 AGTGAGGAAGAGGCGTTCAA Chr5:64724741..64724760 59.99 50
upstream ENSMUSE00000186570 Chr5:64726517..64726676 CACGATTACCACCGAGACCT Chr5:64726547..64726566 59.99 55
upstream ENSMUSE00000186562 Chr5:64730801..64730970 GGAGCCATAAGCCCTTGATT Chr5:64730858..64730877 60.42 50

*** Putative Vector Insertion (Chr 5: 64730971 - 64736490) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186575 Chr5:64736491..64736664 GAGCACGTGGTACTCGACCT Chr5:64736553..64736572 60.33 60
downstream ENSMUSE00000370716 Chr5:64740969..64742725 ATCTTAGGAGCCCCTGGAAA Chr5:64742038..64742057 60.03 50
downstream ENSMUSE00000718703 Chr5:64740969..64742717 ATCTTAGGAGCCCCTGGAAA Chr5:64742038..64742057 60.03 50
downstream ENSMUSE00000721292 Chr5:64740969..64742721 ATCTTAGGAGCCCCTGGAAA Chr5:64742038..64742057 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCTTTCTGCATCAGTCAT Chr5:64731003..64731023 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCCTTTCTGCATCAGTCA Chr5:64731002..64731022 60.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029174