Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7145
Trapped Gene
Hiatl1 (ENSMUSG00000038212)
Vector Insertion
Chr 13: 65197023 - 65213811
Public Clones RRJ602 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479431 (Chr13:65213812..65214252 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGCGCTACTGAAAACTAC Chr13:65214167..65214186 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479431 (Chr13:65213812..65214252 -)
Downstram Exon
ENSMUSE00000384287 (Chr13:65196927..65197022 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGCGCTACTGAAAACTAC Chr13:65214167..65214186 59.9 55 GCAGCATGGTAAACACTTGG Chr13:65196963..65196982 59.2 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479431 Chr13:65213812..65214252 CGGGCGCTACTGAAAACTAC Chr13:65214167..65214186 59.9 55

*** Putative Vector Insertion (Chr 13: 65197023 - 65213811) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000384287 Chr13:65196927..65197022 GCAGCATGGTAAACACTTGG Chr13:65196963..65196982 59.2 50
downstream ENSMUSE00000320640 Chr13:65188397..65188459 AATGAGCCCATTCATGAGGA Chr13:65188387..65188406 60.43 45
downstream ENSMUSE00000320692 Chr13:65182708..65182835 GAGCGGAGCACTCAGAAAAG Chr13:65182784..65182803 60.28 55
downstream ENSMUSE00000320682 Chr13:65179662..65179776 No primer for this exon
downstream ENSMUSE00000320673 Chr13:65176792..65177010 TCCGCTTGTTTCCAAGAGAT Chr13:65176780..65176799 59.81 45
downstream ENSMUSE00000320666 Chr13:65176294..65176407 GCTTGAATATTGCCCAGCTT Chr13:65176293..65176312 59.32 45
downstream ENSMUSE00000320739 Chr13:65174864..65174935 TGAGCCACAATGGACAGAAT Chr13:65174843..65174862 59.09 45
downstream ENSMUSE00000320730 Chr13:65173313..65173425 AAACCATACCAGGCAAGCTG Chr13:65173306..65173325 60.13 50
downstream ENSMUSE00000320722 Chr13:65170952..65171049 TGGGAATGTAATGCTGGACA Chr13:65170976..65170995 59.92 45
downstream ENSMUSE00000418509 Chr13:65169171..65169313 ATTGCACAGCCCTCGTATTC Chr13:65169248..65169267 60.1 50
downstream ENSMUSE00000332270 Chr13:65166359..65168169 AAAGACCGACCACCTTTCCT Chr13:65167577..65167596 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr13:65198741..65198761 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGGGACTCTGGGATTGTG Chr13:65198769..65198789 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038212