Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7169
Trapped Gene
2410004L22Rik (ENSMUSG00000035439)
Vector Insertion
Chr 8: 73781325 - 73786950
Public Clones RRU416 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000223074 (Chr8:73786951..73787003 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCGGTATCTGCAATATGA Chr8:73786967..73786986 58.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000223074 (Chr8:73786951..73787003 -)
Downstram Exon
ENSMUSE00000223071 (Chr8:73781255..73781324 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCGGTATCTGCAATATGA Chr8:73786967..73786986 58.94 45 CTAGGCACTGTGCTGGCTTT Chr8:73781241..73781260 60.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607215 Chr8:73796183..73796275 GAGACGCTTGCCTTTGAGTG Chr8:73796224..73796243 61.12 55
upstream ENSMUSE00000717764 Chr8:73796183..73796275 GAGACGCTTGCCTTTGAGTG Chr8:73796224..73796243 61.12 55
upstream ENSMUSE00000223079 Chr8:73793125..73793183 CTTGTGCTGTTCCCAAGACA Chr8:73793144..73793163 59.87 50
upstream ENSMUSE00000223074 Chr8:73786951..73787003 TCCCGGTATCTGCAATATGA Chr8:73786967..73786986 58.94 45

*** Putative Vector Insertion (Chr 8: 73781325 - 73786950) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000223071 Chr8:73781255..73781324 CTAGGCACTGTGCTGGCTTT Chr8:73781241..73781260 60.59 55
downstream ENSMUSE00000223065 Chr8:73780358..73780450 CGATGGCAGAGAGGTCTAGG Chr8:73780339..73780358 59.97 60
downstream ENSMUSE00000682645 Chr8:73780358..73780453 CGATGGCAGAGAGGTCTAGG Chr8:73780339..73780358 59.97 60
downstream ENSMUSE00000223058 Chr8:73779907..73780019 CGTCTTTTCTTCCGAAGGATT Chr8:73779886..73779906 59.71 42.86
downstream ENSMUSE00000223051 Chr8:73779546..73779611 TCACAGACAGCAGGGTCATC Chr8:73779526..73779545 59.83 55
downstream ENSMUSE00000223046 Chr8:73779306..73779464 TGGCTGCCAAGTCTTTCTCT Chr8:73779388..73779407 60.13 50
downstream ENSMUSE00000223042 Chr8:73778420..73778561 TGCCCAGTGTCATGTATTCC Chr8:73778473..73778492 59.37 50
downstream ENSMUSE00000223036 Chr8:73776970..73777153 ATGCTCAGATCACCCAGGAG Chr8:73777077..73777096 60.22 55
downstream ENSMUSE00000412309 Chr8:73775024..73775443 TGAAGTACCACTGGCTGCTG Chr8:73775306..73775325 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGGGTGAGGTGGAGGTA Chr8:73786897..73786917 59.96 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTGTGAGTGGGTGAGGT Chr8:73786904..73786924 61.06 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035439