Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7184
Trapped Gene
1600014K23Rik (ENSMUSG00000031708)
Vector Insertion
Chr 8: 86098428 - 86118238
Public Clones (sanger) (sanger) RRU393 (baygenomics) RRS786 (baygenomics) E005C03 (ggtc)
5SD124B02 (ggtc)
Private Clones OST433613 (lexicon) OST426787 (lexicon) OST267675 (lexicon) OST142447 (lexicon)
OST142392 (lexicon) OST125872 (lexicon) OST22664 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681734 (Chr8:86118239..86118361 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTCAGTTGCAGCAGAGCAG Chr8:86118275..86118294 59.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681734 (Chr8:86118239..86118361 -)
Downstram Exon
ENSMUSE00000277901 (Chr8:86098377..86098427 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTCAGTTGCAGCAGAGCAG Chr8:86118275..86118294 59.52 55 CACAGCTTCTCCCTCGTCTT Chr8:86098368..86098387 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681734 Chr8:86118239..86118361 ACTCAGTTGCAGCAGAGCAG Chr8:86118275..86118294 59.52 55

*** Putative Vector Insertion (Chr 8: 86098428 - 86118238) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277901 Chr8:86098377..86098427 CACAGCTTCTCCCTCGTCTT Chr8:86098368..86098387 59.6 55
downstream ENSMUSE00000212217 Chr8:86097770..86097821 No primer for this exon
downstream ENSMUSE00000212210 Chr8:86097310..86097354 No primer for this exon
downstream ENSMUSE00000212212 Chr8:86097119..86097222 GGTCCCGGAAGTAGAGTGTG Chr8:86097123..86097142 59.57 60
downstream ENSMUSE00000212208 Chr8:86096927..86097042 ATTTGCGGCCATAAATGAAG Chr8:86096939..86096958 59.93 40
downstream ENSMUSE00000212216 Chr8:86096740..86096845 ATGGTTCCGTGAGAGAATCG Chr8:86096740..86096759 60.07 50
downstream ENSMUSE00000212209 Chr8:86096580..86096652 AGCCCCAATAGTAGGTGCAG Chr8:86096609..86096628 59.22 55
downstream ENSMUSE00000212213 Chr8:86096448..86096491 AGTGCCAGCTTAACCTGCTG Chr8:86096439..86096458 60.59 55
downstream ENSMUSE00000212207 Chr8:86096297..86096354 TGGATGGAGAAGTTCCCAAG Chr8:86096304..86096323 60.04 50
downstream ENSMUSE00000212215 Chr8:86096131..86096219 ACAGGAACAGCCAGGTGAAG Chr8:86096138..86096157 60.3 55
downstream ENSMUSE00000212206 Chr8:86095912..86095957 CTGAGTCAAGATGGCAAAGC Chr8:86095900..86095919 58.6 50
downstream ENSMUSE00000388157 Chr8:86095599..86095834 GTAGTCGCGGAACTCCTTCA Chr8:86095724..86095743 60.4 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACAGGGCCACTGCTTATTT Chr8:86109212..86109232 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGGGCCACTGCTTATTT Chr8:86109212..86109232 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AATCTCAGCCTCGACACCTG Chr8:86115340..86115360 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTTCGTGACTGGGAAAACC Chr8:86109295..86109315 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031708