Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7190
Trapped Gene
Icmt (ENSMUSG00000039662)
Vector Insertion
Chr 4: 151674864 - 151677130
Public Clones RRU481 (baygenomics)
Private Clones OST347853 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000304077 (Chr4:151674646..151674863 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCTTCGGAGAATGCCTGAG Chr4:151674693..151674712 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000304077 (Chr4:151674646..151674863 +)
Downstram Exon
ENSMUSE00000705439 (Chr4:151677131..151678137 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCTTCGGAGAATGCCTGAG Chr4:151674693..151674712 59.95 55 TATTCAGCACGGCAACTCTG Chr4:151677713..151677732 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523809 Chr4:151671393..151671677 AGCCTCGCTACATTCCTCCT Chr4:151671531..151671550 60.37 55
upstream ENSMUSE00000304086 Chr4:151672794..151672882 AGCCAGTCCTCTTGGAATCA Chr4:151672854..151672873 59.8 50
upstream ENSMUSE00000630153 Chr4:151673246..151673279 No primer for this exon
upstream ENSMUSE00000304081 Chr4:151673780..151673949 TACGTGTGCTCGCTGTCTCT Chr4:151673781..151673800 59.8 55
upstream ENSMUSE00000304077 Chr4:151674646..151674863 GTCTTCGGAGAATGCCTGAG Chr4:151674693..151674712 59.95 55

*** Putative Vector Insertion (Chr 4: 151674864 - 151677130) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000705439 Chr4:151677131..151678137 TATTCAGCACGGCAACTCTG Chr4:151677713..151677732 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTGGGCTGGTTTTACTGG Chr4:151674830..151674850 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTGGGCTGGTTTTACTGG Chr4:151674830..151674850 59.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039662