Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7206
Trapped Gene
Zfp341 (ENSMUSG00000059842)
Vector Insertion
Chr 2: 154450788 - 154452513
Public Clones RRU544 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496864 (Chr2:154450591..154450787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTTCTCTGCGGGAAGTGT Chr2:154450603..154450622 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496864 (Chr2:154450591..154450787 +)
Downstram Exon
ENSMUSE00000491760 (Chr2:154452514..154452663 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTTCTCTGCGGGAAGTGT Chr2:154450603..154450622 59.99 50 AAGATGTTCCCTTGCACCAG Chr2:154452581..154452600 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495547 Chr2:154439104..154439138 No primer for this exon
upstream ENSMUSE00000681260 Chr2:154439106..154439138 No primer for this exon
upstream ENSMUSE00000497785 Chr2:154447489..154447599 GGACAATCAAACGGTTCTGG Chr2:154447493..154447512 60.35 50
upstream ENSMUSE00000496864 Chr2:154450591..154450787 TCTTTCTCTGCGGGAAGTGT Chr2:154450603..154450622 59.99 50

*** Putative Vector Insertion (Chr 2: 154450788 - 154452513) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000491760 Chr2:154452514..154452663 AAGATGTTCCCTTGCACCAG Chr2:154452581..154452600 60.11 50
downstream ENSMUSE00000490939 Chr2:154453624..154453869 AGGTAATTGGGCACAGGATG Chr2:154453661..154453680 59.81 50
downstream ENSMUSE00000493731 Chr2:154454536..154454731 GGAGTCCACTGGCACCTTTA Chr2:154454728..154454747 60.11 55
downstream ENSMUSE00000681259 Chr2:154454536..154454710 CTCCACACACTGGCTTGGTA Chr2:154454559..154454578 59.74 55
downstream ENSMUSE00000492783 Chr2:154456145..154456235 TTCGGATATGCTGCTGAAGA Chr2:154456237..154456256 59.52 45
downstream ENSMUSE00000488215 Chr2:154458015..154458205 GGTCACAGAGTTTCGGGAGA Chr2:154458159..154458178 60.24 55
downstream ENSMUSE00000487271 Chr2:154459823..154460013 GGCTTGTCACCTTCATCCTC Chr2:154459901..154459920 59.66 55
downstream ENSMUSE00000490050 Chr2:154463750..154463958 AGTGAGGGGAAGTCCTTGCT Chr2:154463883..154463902 60.25 55
downstream ENSMUSE00000489116 Chr2:154467052..154467148 CCTCGGGAGTGGAGTATTTG Chr2:154467092..154467111 59.54 55
downstream ENSMUSE00000483787 Chr2:154467718..154467850 GTAGCGTTCACAGGGGAAGA Chr2:154467741..154467760 60.26 55
downstream ENSMUSE00000486547 Chr2:154469225..154469336 TCGTGGATCAGCATGTGTCT Chr2:154469309..154469328 60.28 50
downstream ENSMUSE00000485444 Chr2:154469523..154469593 TATGGGCTTTCAGCTTGTCC Chr2:154469581..154469600 60.21 50
downstream ENSMUSE00000480830 Chr2:154471360..154472552 ACAGGTGAGGAACGTGGAAC Chr2:154472406..154472425 60.01 55
downstream ENSMUSE00000681258 Chr2:154471360..154472514 ACAGGTGAGGAACGTGGAAC Chr2:154472406..154472425 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTGGCCTGGTTATTCCTT Chr2:154450802..154450822 60.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTGGCCTGGTTATTCCTT Chr2:154450802..154450822 60.31 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059842