Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7241
Trapped Gene
Rap1a (ENSMUSG00000068798)
Vector Insertion
Chr 3: 105548891 - 105553162
Public Clones RRT125 (baygenomics)
Private Clones OST326374 (lexicon) OST199451 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000366919 (Chr3:105553163..105553246 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000366919 (Chr3:105553163..105553246 -)
Downstram Exon
ENSMUSE00000565620 (Chr3:105548822..105548890 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAACAAAAATCCCCTGAACA Chr3:105548837..105548857 60.33 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423306 Chr3:105604157..105604254 AGAGGAGGGAGGAGGAGGAG Chr3:105604181..105604200 61.24 65
upstream ENSMUSE00000366919 Chr3:105553163..105553246 No primer for this exon

*** Putative Vector Insertion (Chr 3: 105548891 - 105553162) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000565620 Chr3:105548822..105548890 TCAACAAAAATCCCCTGAACA Chr3:105548837..105548857 60.33 38.1
downstream ENSMUSE00000364184 Chr3:105544264..105544320 TGCACTGTTGGCAATCTACC Chr3:105544271..105544290 59.72 50
downstream ENSMUSE00000565619 Chr3:105542432..105542572 AACCCTTGGCCATTCTTCAT Chr3:105542501..105542520 60.69 45
downstream ENSMUSE00000565618 Chr3:105540673..105540816 TGCCAACTACCCGTTCATCT Chr3:105540737..105540756 60.52 50
downstream ENSMUSE00000565617 Chr3:105534874..105534989 AGCTGCTGCTGACTTCAGGT Chr3:105534861..105534880 60.35 55
downstream ENSMUSE00000636883 Chr3:105531201..105531882 GGGAACTTGTGCAAACCAAT Chr3:105531724..105531743 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGAAGTCTGCTCTGGTAA Chr3:105553157..105553177 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGAAGTCTGCTCTGGTAA Chr3:105553157..105553177 59.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068798