Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7253
Trapped Gene
Vps13c (ENSMUSG00000035284)
Vector Insertion
Chr 9: 67767179 - 67768665
Public Clones RRT161 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000584091 (Chr9:67767045..67767178 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGACCAGACCCGTAGACA Chr9:67767124..67767143 60.11 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000584091 (Chr9:67767045..67767178 +)
Downstram Exon
ENSMUSE00000357835 (Chr9:67768666..67768822 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGACCAGACCCGTAGACA Chr9:67767124..67767143 60.11 60 AGTTCATGAAAGGGGCTTCC Chr9:67768724..67768743 60.44 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000584106 Chr9:67688203..67688333 GGGGACTACGTGGAGAACCT Chr9:67688279..67688298 60.37 60
upstream ENSMUSE00000238268 Chr9:67688219..67688333 GGGGACTACGTGGAGAACCT Chr9:67688279..67688298 60.37 60
upstream ENSMUSE00000239022 Chr9:67700298..67700341 No primer for this exon
upstream ENSMUSE00000239005 Chr9:67701503..67701545 No primer for this exon
upstream ENSMUSE00000238990 Chr9:67706597..67706692 AGTCGTTGCCACGCTAGAAG Chr9:67706643..67706662 60.59 55
upstream ENSMUSE00000238969 Chr9:67708591..67708692 CTTTGCCGAATTGAAGAAGC Chr9:67708650..67708669 59.96 45
upstream ENSMUSE00000238957 Chr9:67713987..67714049 GCACACTCAGGGGAGTTCAT Chr9:67713989..67714008 60.12 55
upstream ENSMUSE00000238938 Chr9:67718660..67718725 AGGTCTTGATCGCTCCAAAG Chr9:67718706..67718725 59.43 50
upstream ENSMUSE00000238913 Chr9:67718983..67719092 TGGAAAAATTGGCAACTCAA Chr9:67719016..67719035 59.13 35
upstream ENSMUSE00000712052 Chr9:67721662..67721721 TTCATTTGGTGTCACCCTGA Chr9:67721685..67721704 59.94 45
upstream ENSMUSE00000720928 Chr9:67721662..67721721 TTCATTTGGTGTCACCCTGA Chr9:67721685..67721704 59.94 45
upstream ENSMUSE00000238865 Chr9:67724034..67724093 AACACTGGACTCCATGCATTT Chr9:67724044..67724064 59.47 42.86
upstream ENSMUSE00000696506 Chr9:67724034..67724093 AACACTGGACTCCATGCATTT Chr9:67724044..67724064 59.47 42.86
upstream ENSMUSE00000238835 Chr9:67725904..67725984 AGTCTCAGCGCCTATTGGAA Chr9:67725919..67725938 59.98 50
upstream ENSMUSE00000696504 Chr9:67725904..67725984 AGTCTCAGCGCCTATTGGAA Chr9:67725919..67725938 59.98 50
upstream ENSMUSE00000238802 Chr9:67726885..67726942 No primer for this exon
upstream ENSMUSE00000696501 Chr9:67726885..67726942 No primer for this exon
upstream ENSMUSE00000238785 Chr9:67729137..67729264 GGGAACGTAGAGGTGCAGAA Chr9:67729217..67729236 60.26 55
upstream ENSMUSE00000696498 Chr9:67729137..67729264 GGGAACGTAGAGGTGCAGAA Chr9:67729217..67729236 60.26 55
upstream ENSMUSE00000238766 Chr9:67731260..67731366 ACAAACCTTGCTTGCCACTT Chr9:67731327..67731346 59.78 45
upstream ENSMUSE00000696495 Chr9:67731260..67731366 ACAAACCTTGCTTGCCACTT Chr9:67731327..67731346 59.78 45
upstream ENSMUSE00000238741 Chr9:67732379..67732550 CAAAATGGCCTACAAAACCAA Chr9:67732484..67732504 59.85 38.1
upstream ENSMUSE00000696491 Chr9:67732379..67732550 CAAAATGGCCTACAAAACCAA Chr9:67732484..67732504 59.85 38.1
upstream ENSMUSE00000238719 Chr9:67734064..67734126 No primer for this exon
upstream ENSMUSE00000696488 Chr9:67734064..67734126 No primer for this exon
upstream ENSMUSE00000238695 Chr9:67737493..67737619 AAACGTGGCTGGTTTAGTGG Chr9:67737544..67737563 60.03 50
upstream ENSMUSE00000696486 Chr9:67737493..67737619 AAACGTGGCTGGTTTAGTGG Chr9:67737544..67737563 60.03 50
upstream ENSMUSE00000238672 Chr9:67738102..67738196 CACTGCCATTGGGTACAGTG Chr9:67738145..67738164 60.03 55
upstream ENSMUSE00000696483 Chr9:67738102..67738196 CACTGCCATTGGGTACAGTG Chr9:67738145..67738164 60.03 55
upstream ENSMUSE00000238650 Chr9:67740888..67741030 No primer for this exon
upstream ENSMUSE00000696479 Chr9:67740888..67741030 No primer for this exon
upstream ENSMUSE00000238627 Chr9:67741765..67741957 GCGACAACAAGACATTGTGC Chr9:67741804..67741823 60.32 50
upstream ENSMUSE00000696476 Chr9:67741765..67741957 GCGACAACAAGACATTGTGC Chr9:67741804..67741823 60.32 50
upstream ENSMUSE00000238606 Chr9:67743137..67743251 TCAGTCAAATAAGGGGTTGGA Chr9:67743166..67743186 59.42 42.86
upstream ENSMUSE00000696473 Chr9:67743137..67743251 TCAGTCAAATAAGGGGTTGGA Chr9:67743166..67743186 59.42 42.86
upstream ENSMUSE00000238592 Chr9:67743895..67744031 CCACAGACAGGTTTTCACCA Chr9:67743969..67743988 59.56 50
upstream ENSMUSE00000696471 Chr9:67743895..67744031 CCACAGACAGGTTTTCACCA Chr9:67743969..67743988 59.56 50
upstream ENSMUSE00000238580 Chr9:67744881..67745004 No primer for this exon
upstream ENSMUSE00000696469 Chr9:67744881..67745004 No primer for this exon
upstream ENSMUSE00000584105 Chr9:67746440..67746557 GATTCCAGCATCCATCGACT Chr9:67746461..67746480 60.04 50
upstream ENSMUSE00000696515 Chr9:67747815..67747823 No primer for this exon
upstream ENSMUSE00000343885 Chr9:67749252..67749381 TAAAGGATGCGCTGTGTTTG Chr9:67749308..67749327 59.87 45
upstream ENSMUSE00000584104 Chr9:67749252..67749381 TAAAGGATGCGCTGTGTTTG Chr9:67749308..67749327 59.87 45
upstream ENSMUSE00000696514 Chr9:67749260..67749381 TAAAGGATGCGCTGTGTTTG Chr9:67749308..67749327 59.87 45
upstream ENSMUSE00000238547 Chr9:67750648..67750726 AGGGACGAAAGCACTTCTTG Chr9:67750674..67750693 59.47 50
upstream ENSMUSE00000584103 Chr9:67750648..67750726 AGGGACGAAAGCACTTCTTG Chr9:67750674..67750693 59.47 50
upstream ENSMUSE00000238147 Chr9:67751366..67751505 GCAGGCTGCTAGAACTGTCA Chr9:67751406..67751425 59.34 55
upstream ENSMUSE00000584102 Chr9:67751366..67751505 GCAGGCTGCTAGAACTGTCA Chr9:67751406..67751425 59.34 55
upstream ENSMUSE00000584101 Chr9:67753600..67753753 CCTGACTGCGGTGTCCTATT Chr9:67753698..67753717 60.13 55
upstream ENSMUSE00000635825 Chr9:67753600..67753617 No primer for this exon
upstream ENSMUSE00000584100 Chr9:67755799..67755878 TCCAGAAAGAAGCCAATTCA Chr9:67755801..67755820 58.42 40
upstream ENSMUSE00000584099 Chr9:67757369..67757428 GGAATGGGCCTAGTTTTCAA Chr9:67757376..67757395 59.02 45
upstream ENSMUSE00000584098 Chr9:67757903..67758062 CTGTTGCTACAAACGCAAGC Chr9:67757924..67757943 59.68 50
upstream ENSMUSE00000584097 Chr9:67759314..67759430 CGTGATTGGCTTTAGGCTGT Chr9:67759339..67759358 60.27 50
upstream ENSMUSE00000584096 Chr9:67760738..67760841 GCCAGGCTGGAAAACATTATT Chr9:67760785..67760805 60.33 42.86
upstream ENSMUSE00000584095 Chr9:67761013..67761180 CGTCGGCTGTATTCAGATTG Chr9:67761129..67761148 59.3 50
upstream ENSMUSE00000584094 Chr9:67761614..67761918 ATTGTCATTCCGCAGTCCTC Chr9:67761758..67761777 60.08 50
upstream ENSMUSE00000584093 Chr9:67763388..67763535 TCAGCTGTTGCACCCAATTA Chr9:67763424..67763443 60.26 45
upstream ENSMUSE00000584092 Chr9:67764153..67764261 GAGGCCACTGAAGACTTGGA Chr9:67764213..67764232 60.39 55
upstream ENSMUSE00000584091 Chr9:67767045..67767178 GGAGACCAGACCCGTAGACA Chr9:67767124..67767143 60.11 60

*** Putative Vector Insertion (Chr 9: 67767179 - 67768665) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000357835 Chr9:67768666..67768822 AGTTCATGAAAGGGGCTTCC Chr9:67768724..67768743 60.44 50
downstream ENSMUSE00000396651 Chr9:67769647..67769726 TCAGGAGGATCCCATCAGAC Chr9:67769712..67769731 60.01 55
downstream ENSMUSE00000238128 Chr9:67770651..67770710 TCTGGTCCATCACTGTCTGC Chr9:67770673..67770692 59.83 55
downstream ENSMUSE00000238099 Chr9:67771487..67771649 CCACAAGTGGCTTTAGCTCAG Chr9:67771621..67771641 60.06 52.38
downstream ENSMUSE00000238075 Chr9:67773577..67773690 TCTTCAAATCAAACGCGTCA Chr9:67773618..67773637 60.38 40
downstream ENSMUSE00000238050 Chr9:67774727..67774830 TCTGCTTTGGCTTCACAGAA Chr9:67774765..67774784 59.72 45
downstream ENSMUSE00000238033 Chr9:67775169..67775336 GGAACCGGAAGACTTCATCTC Chr9:67775207..67775227 60.07 52.38
downstream ENSMUSE00000238011 Chr9:67777168..67777472 TGACAGGTGCTTTCAAATCG Chr9:67777315..67777334 59.84 45
downstream ENSMUSE00000237990 Chr9:67778421..67778568 TGACAAATTCCGCTGTATGC Chr9:67778511..67778530 59.69 45
downstream ENSMUSE00000237972 Chr9:67780247..67780397 GGCCCACTCCGAGTATCTCT Chr9:67780386..67780405 60.62 60
downstream ENSMUSE00000237956 Chr9:67782248..67782357 CTGAAGAGTGACGGTCTGGTC Chr9:67782302..67782322 59.89 57.14
downstream ENSMUSE00000369159 Chr9:67784099..67784268 CTCACCCAAACGGAAACTGT Chr9:67784146..67784165 60.01 50
downstream ENSMUSE00000584090 Chr9:67785466..67785713 AGAAATCAGCCACGGTCATC Chr9:67785620..67785639 60.08 50
downstream ENSMUSE00000584089 Chr9:67786730..67786959 CTGTGATCATGGCCTTCAGA Chr9:67786777..67786796 59.79 50
downstream ENSMUSE00000584088 Chr9:67788266..67788358 CCCATGTGCACTTTTCCATA Chr9:67788311..67788330 59.4 45
downstream ENSMUSE00000584087 Chr9:67791164..67791529 CAGCGGCCATTAGAGAAGTC Chr9:67791512..67791531 59.98 55
downstream ENSMUSE00000584086 Chr9:67791852..67791938 TTTAAGCTCCACGGCTTGTT Chr9:67791934..67791953 59.88 45
downstream ENSMUSE00000584085 Chr9:67793294..67793443 ATCCTGGATCGGGTTTTTCT Chr9:67793320..67793339 59.77 45
downstream ENSMUSE00000584084 Chr9:67793631..67793895 CCAGCGCATTTTTGACTGTA Chr9:67793712..67793731 59.87 45
downstream ENSMUSE00000584083 Chr9:67795924..67796084 CTTCTGTTGCGTCAATCTGC Chr9:67796052..67796071 59.6 50
downstream ENSMUSE00000584082 Chr9:67797123..67797244 GGAATCCAGAGGAACATGGA Chr9:67797242..67797261 59.86 50
downstream ENSMUSE00000584081 Chr9:67798040..67798334 AGCGAATACGGGAGAAGGTT Chr9:67798321..67798340 60.1 50
downstream ENSMUSE00000584080 Chr9:67799117..67799506 GTGAGTGAAGGACGTCAGCA Chr9:67799177..67799196 60.03 55
downstream ENSMUSE00000584079 Chr9:67800741..67800845 CTTCACACACCCGTAACTGC Chr9:67800821..67800840 59.21 55
downstream ENSMUSE00000483132 Chr9:67801531..67801695 TGGTGGGTATGGAACCATCT Chr9:67801669..67801688 60.05 50
downstream ENSMUSE00000237578 Chr9:67802345..67802473 CCGTTGTCTTGTCGGTTGTA Chr9:67802451..67802470 59.61 50
downstream ENSMUSE00000237550 Chr9:67802739..67802872 CGCAGACCCCTCATGATAGT Chr9:67802822..67802841 60.1 55
downstream ENSMUSE00000237529 Chr9:67803474..67803600 TCATGCTCCCCAAAGTTAGC Chr9:67803593..67803612 60.21 50
downstream ENSMUSE00000490181 Chr9:67805308..67805543 GTTCGCATCGTACGGAAACT Chr9:67805343..67805362 60.14 50
downstream ENSMUSE00000489119 Chr9:67809401..67809542 GCTCCAGGGACATTATCTGC Chr9:67809480..67809499 59.66 55
downstream ENSMUSE00000488083 Chr9:67810856..67810996 ATTTCCATCGGCACTTTGTC Chr9:67810887..67810906 59.94 45
downstream ENSMUSE00000487056 Chr9:67811866..67811947 GGGAACATTGTGCCTGGTAA Chr9:67811900..67811919 60.76 50
downstream ENSMUSE00000237394 Chr9:67812051..67812120 TCACATCGATGAAAGGCTTG Chr9:67812077..67812096 59.8 45
downstream ENSMUSE00000237364 Chr9:67813272..67813383 AAGGAAGCCCTGATCAACCT Chr9:67813329..67813348 60.07 50
downstream ENSMUSE00000237331 Chr9:67813492..67813605 ACAGGGGAAATGTGGAAATG Chr9:67813604..67813623 59.65 45
downstream ENSMUSE00000237307 Chr9:67814847..67814986 TCCGTCAGAGTGGCACCTAT Chr9:67814968..67814987 60.68 55
downstream ENSMUSE00000237272 Chr9:67817082..67817163 No primer for this exon
downstream ENSMUSE00000484142 Chr9:67819795..67819908 GGGTTTCCAAGCACGTCTAA Chr9:67819850..67819869 60.11 50
downstream ENSMUSE00000532256 Chr9:67820668..67820743 CGAGACTTCTCACCCCAATC Chr9:67820731..67820750 59.65 55
downstream ENSMUSE00000635801 Chr9:67821089..67821252 CCCAACTGACCCAGTGATTC Chr9:67821135..67821154 60.36 55
downstream ENSMUSE00000635799 Chr9:67821519..67821564 AGTCACCCCACCAACAACTC Chr9:67821542..67821561 59.86 55
downstream ENSMUSE00000635796 Chr9:67823589..67823712 ATCTATGATCCCGCCAGTTG Chr9:67823683..67823702 59.92 50
downstream ENSMUSE00000635795 Chr9:67830312..67830426 ACCGTCTTCGTGGATCAGAC Chr9:67830378..67830397 60.12 55
downstream ENSMUSE00000696510 Chr9:67831130..67831153 No primer for this exon
downstream ENSMUSE00000584072 Chr9:67835770..67835858 GGCACAGTGGAACTGGTAGG Chr9:67835820..67835839 60.57 60
downstream ENSMUSE00000584071 Chr9:67840745..67840868 ACAGACACTGCCAGTCCACA Chr9:67840812..67840831 60.37 55
downstream ENSMUSE00000584070 Chr9:67842667..67842750 TGTGATGGGATCCTTCAGGT Chr9:67842747..67842766 60.33 50
downstream ENSMUSE00000584069 Chr9:67843095..67843441 CAAGGAATCGCTGGAAATGT Chr9:67843278..67843297 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr9:67767229..67767249 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGATTATGGCTCGTGACTGG Chr9:67767217..67767239 60.5 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035284