Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7258
Trapped Gene
Med13l (ENSMUSG00000018076)
Vector Insertion
Chr 5: 119209273 - 119211294
Public Clones RRT211 (baygenomics) RRT464 (baygenomics)
Private Clones OST410733 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000289858 (Chr5:119209111..119209272 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000289858 (Chr5:119209111..119209272 +)
Downstram Exon
ENSMUSE00000650454 (Chr5:119211295..119211407 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000538988 Chr5:119010752..119010866 No primer for this exon
upstream ENSMUSE00000352988 Chr5:119043342..119043579 No primer for this exon
upstream ENSMUSE00000290060 Chr5:119121022..119121106 No primer for this exon
upstream ENSMUSE00000290053 Chr5:119130897..119130980 No primer for this exon
upstream ENSMUSE00000483487 Chr5:119168492..119168637 No primer for this exon
upstream ENSMUSE00000484364 Chr5:119171384..119171578 No primer for this exon
upstream ENSMUSE00000466399 Chr5:119171774..119171947 No primer for this exon
upstream ENSMUSE00000467271 Chr5:119173997..119174162 No primer for this exon
upstream ENSMUSE00000498273 Chr5:119176270..119176374 No primer for this exon
upstream ENSMUSE00000495429 Chr5:119178157..119178888 No primer for this exon
upstream ENSMUSE00000496208 Chr5:119179779..119180004 No primer for this exon
upstream ENSMUSE00000493352 Chr5:119180921..119181026 No primer for this exon
upstream ENSMUSE00000494634 Chr5:119181337..119181461 No primer for this exon
upstream ENSMUSE00000491693 Chr5:119183968..119184067 No primer for this exon
upstream ENSMUSE00000492550 Chr5:119188324..119188544 No primer for this exon
upstream ENSMUSE00000505150 Chr5:119188804..119189009 No primer for this exon
upstream ENSMUSE00000289867 Chr5:119191835..119192784 No primer for this exon
upstream ENSMUSE00000289947 Chr5:119195018..119195197 No primer for this exon
upstream ENSMUSE00000290134 Chr5:119195651..119195874 No primer for this exon
upstream ENSMUSE00000188166 Chr5:119197328..119197520 No primer for this exon
upstream ENSMUSE00000289938 Chr5:119198573..119198990 No primer for this exon
upstream ENSMUSE00000289929 Chr5:119199618..119199837 No primer for this exon
upstream ENSMUSE00000188159 Chr5:119200855..119201043 No primer for this exon
upstream ENSMUSE00000188163 Chr5:119201540..119201763 No primer for this exon
upstream ENSMUSE00000290099 Chr5:119201849..119202018 No primer for this exon
upstream ENSMUSE00000188171 Chr5:119204272..119204430 No primer for this exon
upstream ENSMUSE00000188165 Chr5:119205548..119205724 No primer for this exon
upstream ENSMUSE00000289863 Chr5:119207086..119207243 No primer for this exon
upstream ENSMUSE00000289858 Chr5:119209111..119209272 No primer for this exon

*** Putative Vector Insertion (Chr 5: 119209273 - 119211294) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650454 Chr5:119211295..119211407 No primer for this exon
downstream ENSMUSE00000650453 Chr5:119212710..119212989 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCTGGGGTTTAAGACAAGT Chr5:119209287..119209307 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTGGGGTTTAAGACAAGT Chr5:119209287..119209307 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018076