Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7264
Trapped Gene
Adh5 (ENSMUSG00000028138)
Vector Insertion
Chr 3: 138106158 - 138108253
Public Clones (sanger) (sanger) (sanger) RRT235 (baygenomics)
Private Clones OST465769 (lexicon) OST74208 (lexicon) OST63840 (lexicon) OST41077 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176694 (Chr3:138106128..138106157 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176694 (Chr3:138106128..138106157 +)
Downstram Exon
ENSMUSE00000176729 (Chr3:138108254..138108355 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGAGGGGCCACTTCTATCTC Chr3:138108333..138108352 60.04 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000176694 Chr3:138106128..138106157 No primer for this exon

*** Putative Vector Insertion (Chr 3: 138106158 - 138108253) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176729 Chr3:138108254..138108355 GGAGGGGCCACTTCTATCTC Chr3:138108333..138108352 60.04 60
downstream ENSMUSE00000176691 Chr3:138110047..138110188 CAGCTCCGCTCAGGGTATAG Chr3:138110101..138110120 59.99 60
downstream ENSMUSE00000176714 Chr3:138110816..138110903 TGGGATGTAGAGTGGGATGA Chr3:138110847..138110866 58.88 50
downstream ENSMUSE00000176685 Chr3:138113863..138114082 CCGAAGGATCGATTTTAGCA Chr3:138114011..138114030 60.17 45
downstream ENSMUSE00000176731 Chr3:138114208..138114468 TGGCCTTTGCGAATTTATCT Chr3:138114343..138114362 59.68 40
downstream ENSMUSE00000176690 Chr3:138116706..138116841 TGGAATGGACGAGTGGAGAT Chr3:138116803..138116822 60.47 50
downstream ENSMUSE00000176727 Chr3:138117632..138117770 AGATTGCCGGTCACAAATTC Chr3:138117722..138117741 59.94 45
downstream ENSMUSE00000331984 Chr3:138118049..138118463 GTTGCACAATGAGCAGCAAT Chr3:138118254..138118273 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAACCTTAGCGCTCGATCC Chr3:138106114..138106134 62.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACCTTAGCGCTCGATCC Chr3:138106114..138106134 62.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028138