Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7297
Trapped Gene
Plekhm1l (ENSMUSG00000051344)
Vector Insertion
Chr 1: 64866668 - 64907760
Public Clones RRT428 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000357386 (Chr1:64907761..64907824 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACCTGTACTCTCTCGCTGA Chr1:64907771..64907791 60.6 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000357386 (Chr1:64907761..64907824 -)
Downstram Exon
ENSMUSE00000395853 (Chr1:64866510..64866667 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACCTGTACTCTCTCGCTGA Chr1:64907771..64907791 60.6 57.14 TCCTCGAAGGGGTAGAGGAT Chr1:64866503..64866522 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459706 Chr1:65003269..65003398 GAGAAGCCGCTTGTAAACAGA Chr1:65003311..65003331 59.65 47.62
upstream ENSMUSE00000374303 Chr1:64984271..64985113 GGTGCTTTAAGAAGCGTTGC Chr1:64984693..64984712 60.03 50
upstream ENSMUSE00000348305 Chr1:64968124..64969056 CTGTCTTGGATAGCCCCAAA Chr1:64968599..64968618 60.07 50
upstream ENSMUSE00000360192 Chr1:64939326..64939471 AAGGCCAAGGTGTGCAATTA Chr1:64939420..64939439 60.5 45
upstream ENSMUSE00000345595 Chr1:64929703..64929896 AAGTCACTCCGGGCCTATTT Chr1:64929745..64929764 59.96 50
upstream ENSMUSE00000357386 Chr1:64907761..64907824 CCACCTGTACTCTCTCGCTGA Chr1:64907771..64907791 60.6 57.14

*** Putative Vector Insertion (Chr 1: 64866668 - 64907760) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000395853 Chr1:64866510..64866667 TCCTCGAAGGGGTAGAGGAT Chr1:64866503..64866522 60.03 55
downstream ENSMUSE00000629817 Chr1:64835695..64841788 CTCCAAGATGCGTGCAGTAA Chr1:64840731..64840750 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGAATTAATCGCCTTGCAG Chr1:64895695..64895716 59.73 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGGGAAAGAATGAACTC Chr1:64895756..64895776 58.96 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051344