Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7301
Trapped Gene
2810407C02Rik (ENSMUSG00000075700)
Vector Insertion
Chr 3: 58380557 - 58380796
Public Clones RRT661 (baygenomics) P069G11 (ggtc) M098A03 (ggtc) G053A12 (ggtc)
G066C04 (ggtc) G032B10 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674842 (Chr3:58380558..58380795 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGCTGTCTCAATTACGAT Chr3:58380641..58380660 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674842 (Chr3:58380558..58380795 +)
Downstram Exon
ENSMUSE00000660055 (Chr3:58380603..58380795 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGCTGTCTCAATTACGAT Chr3:58380641..58380660 60.24 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 3: 58380557 - 58380796) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674842 Chr3:58380558..58380795 AACCTAGCCACGAACTGCTC Chr3:58380610..58380629 59.5 55
downstream ENSMUSE00000660055 Chr3:58380603..58380795 No primer for this exon
downstream ENSMUSE00000660056 Chr3:58389153..58389263 GGATACCGCTGGCTGATAAC Chr3:58389218..58389237 59.56 55
downstream ENSMUSE00000173238 Chr3:58389874..58390000 TTATTTTCTTGGCCCCACTG Chr3:58390002..58390021 59.93 45
downstream ENSMUSE00000173240 Chr3:58392368..58392455 TCTCAATCATGTTGCTCAGGA Chr3:58392415..58392435 59.38 42.86
downstream ENSMUSE00000660057 Chr3:58394086..58394213 TGATCGATGATGTGGGATTG Chr3:58394213..58394232 60.29 45
downstream ENSMUSE00000674839 Chr3:58394089..58394242 TTCGGTGCTGATAGGTAGGG Chr3:58394236..58394255 60.09 55
downstream ENSMUSE00000674838 Chr3:58394617..58397055 TCTCCCATTGCAGTTCCTTC Chr3:58395878..58395897 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000075700