Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7310
Trapped Gene
Hira (ENSMUSG00000022702)
Vector Insertion
Chr 16: 18956351 - 18969532
Public Clones XF166 (baygenomics) RRT008 (baygenomics) XK082 (baygenomics) RRI189 (baygenomics)
RRT536 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000129621 (Chr16:18956262..18956350 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATACCGCCTCCGTGAAATA Chr16:18956268..18956287 59.43 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000129621 (Chr16:18956262..18956350 +)
Downstram Exon
ENSMUSE00000413153 (Chr16:18969533..18970399 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATACCGCCTCCGTGAAATA Chr16:18956268..18956287 59.43 45 ATCGAAGATTCTGCCCAATG Chr16:18969596..18969615 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000270336 Chr16:18876843..18877612 TCTAATAAATGCGCCCGTCT Chr16:18876909..18876928 59.7 45
upstream ENSMUSE00000719731 Chr16:18877130..18877307 ATCAGTGGCAGCGGAGTATC Chr16:18877204..18877223 60.25 55
upstream ENSMUSE00000460992 Chr16:18894867..18894929 ACCCTGATGGGACCAAGTTT Chr16:18894894..18894913 60.61 50
upstream ENSMUSE00000711859 Chr16:18894867..18894929 ACCCTGATGGGACCAAGTTT Chr16:18894894..18894913 60.61 50
upstream ENSMUSE00000464065 Chr16:18896547..18896657 CAGGAGGATGACGAGAAGGA Chr16:18896594..18896613 60.34 55
upstream ENSMUSE00000711463 Chr16:18896547..18896657 CAGGAGGATGACGAGAAGGA Chr16:18896594..18896613 60.34 55
upstream ENSMUSE00000129623 Chr16:18897791..18897881 TTCTGGGGGAGATGACAAAC Chr16:18897837..18897856 59.9 50
upstream ENSMUSE00000129642 Chr16:18899456..18899550 GGTAAGCTTGCCAATGTGGA Chr16:18899490..18899509 61.03 50
upstream ENSMUSE00000129640 Chr16:18910741..18910836 CATGCAGCGTGGATAACACT Chr16:18910786..18910805 59.75 50
upstream ENSMUSE00000129643 Chr16:18912139..18912299 TGGGATCCCGTTGGTAAATA Chr16:18912189..18912208 60.01 45
upstream ENSMUSE00000129619 Chr16:18916533..18916700 ACCGGAAAGCTGTGACTGTT Chr16:18916678..18916697 59.77 50
upstream ENSMUSE00000129622 Chr16:18919069..18919182 AGGACCGCTCACTCTCTGTC Chr16:18919160..18919179 59.58 60
upstream ENSMUSE00000129634 Chr16:18922410..18922480 GTTTGAAACGGCCTCTGGTT Chr16:18922417..18922436 61.41 50
upstream ENSMUSE00000129618 Chr16:18922947..18923052 TCAGGATGAACTCGGAGACC Chr16:18923013..18923032 60.2 55
upstream ENSMUSE00000129641 Chr16:18925741..18925956 GCTCAAGTACCAGCGGAGAC Chr16:18925830..18925849 60.02 60
upstream ENSMUSE00000129636 Chr16:18927531..18927616 AGATGGTCGGAGGAGAATCA Chr16:18927566..18927585 59.61 50
upstream ENSMUSE00000714973 Chr16:18927531..18928123 AGAATCACGCCTCTTTGCAT Chr16:18927579..18927598 59.84 45
upstream ENSMUSE00000129630 Chr16:18932961..18933155 AAGCCTTGCACAGAACCAGT Chr16:18933088..18933107 59.91 50
upstream ENSMUSE00000484139 Chr16:18935111..18935272 ATTTGATTCCCGGTTCACAG Chr16:18935189..18935208 59.79 45
upstream ENSMUSE00000129612 Chr16:18946439..18946640 AAGAAAGGTCGCCCTAGGAA Chr16:18946584..18946603 60.2 50
upstream ENSMUSE00000129613 Chr16:18947507..18947611 AAGGAGGCCATGTGTCTGTC Chr16:18947531..18947550 60.12 55
upstream ENSMUSE00000129628 Chr16:18949229..18949377 GAAGGAGTGGGAGACAGTGC Chr16:18949324..18949343 59.84 60
upstream ENSMUSE00000129610 Chr16:18951268..18951429 GGATGCTGTCGGTGTTCTCT Chr16:18951297..18951316 60.27 55
upstream ENSMUSE00000129603 Chr16:18951750..18951808 CACAGACAGGTGGTTGTGGT Chr16:18951757..18951776 59.46 55
upstream ENSMUSE00000129615 Chr16:18952157..18952262 CATGGAATCCCAGTGATGAA Chr16:18952195..18952214 59.3 45
upstream ENSMUSE00000129632 Chr16:18954088..18954210 TGCTTTGTTCAGGACCGTTA Chr16:18954165..18954184 59.32 45
upstream ENSMUSE00000129611 Chr16:18954703..18954866 CTGCAGTCAAGCCACGAGTA Chr16:18954803..18954822 60.2 55
upstream ENSMUSE00000129621 Chr16:18956262..18956350 AATACCGCCTCCGTGAAATA Chr16:18956268..18956287 59.43 45

*** Putative Vector Insertion (Chr 16: 18956351 - 18969532) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000413153 Chr16:18969533..18970399 ATCGAAGATTCTGCCCAATG Chr16:18969596..18969615 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCTACTTGTCTCCTGCAC Chr16:18962338..18962358 59.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGACAGTCCTGGTCTTTGG Chr16:18965306..18965326 61.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022702