Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7317
Trapped Gene
Fxr2 (ENSMUSG00000018765)
Vector Insertion
Chr 11: 69457457 - 69462306
Public Clones RRU006 (baygenomics)
Private Clones OST224651 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111798 (Chr11:69457340..69457456 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111798 (Chr11:69457340..69457456 +)
Downstram Exon
ENSMUSE00000111794 (Chr11:69462307..69462477 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677505 Chr11:69446463..69446900 No primer for this exon
upstream ENSMUSE00000329853 Chr11:69446473..69446900 No primer for this exon
upstream ENSMUSE00000111806 Chr11:69452892..69452944 No primer for this exon
upstream ENSMUSE00000329832 Chr11:69453736..69453829 No primer for this exon
upstream ENSMUSE00000329822 Chr11:69454784..69454855 No primer for this exon
upstream ENSMUSE00000111795 Chr11:69454943..69455091 No primer for this exon
upstream ENSMUSE00000111802 Chr11:69455549..69455642 No primer for this exon
upstream ENSMUSE00000111798 Chr11:69457340..69457456 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69457457 - 69462306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111794 Chr11:69462307..69462477 No primer for this exon
downstream ENSMUSE00000111793 Chr11:69462652..69462730 No primer for this exon
downstream ENSMUSE00000111796 Chr11:69463230..69463339 No primer for this exon
downstream ENSMUSE00000111805 Chr11:69463965..69464051 No primer for this exon
downstream ENSMUSE00000329758 Chr11:69464346..69464574 No primer for this exon
downstream ENSMUSE00000329748 Chr11:69464741..69464938 No primer for this exon
downstream ENSMUSE00000709379 Chr11:69465025..69465225 No primer for this exon
downstream ENSMUSE00000713075 Chr11:69465025..69465225 No primer for this exon
downstream ENSMUSE00000111803 Chr11:69465480..69465575 No primer for this exon
downstream ENSMUSE00000677503 Chr11:69465480..69465575 No primer for this exon
downstream ENSMUSE00000111801 Chr11:69465712..69465809 No primer for this exon
downstream ENSMUSE00000677502 Chr11:69465712..69465809 No primer for this exon
downstream ENSMUSE00000394411 Chr11:69466106..69466799 No primer for this exon
downstream ENSMUSE00000677501 Chr11:69466106..69466799 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCGCAATGAAGAAGCTA Chr11:69460424..69460444 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCCGCAATGAAGAAGCTA Chr11:69460424..69460444 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018765