Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7385
Trapped Gene
Ikbkb (ENSMUSG00000031537)
Vector Insertion
Chr 8: 23774290 - 23775960
Public Clones RRS434 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210543 (Chr8:23775961..23776108 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTTATGAACGAGGACGAG Chr8:23776027..23776046 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210543 (Chr8:23775961..23776108 -)
Downstram Exon
ENSMUSE00000210561 (Chr8:23774162..23774289 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTTATGAACGAGGACGAG Chr8:23776027..23776046 59.84 55 GAAGGCTGGGACATTAGCTG Chr8:23774179..23774198 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490211 Chr8:23816942..23817035 ACCCCGAGTTTTCATGTCCT Chr8:23816981..23817000 60.75 50
upstream ENSMUSE00000521268 Chr8:23816942..23817047 ACCCCGAGTTTTCATGTCCT Chr8:23816981..23817000 60.75 50
upstream ENSMUSE00000258693 Chr8:23816554..23816676 GGCATCGATATGAGCTGGTC Chr8:23816648..23816667 60.6 55
upstream ENSMUSE00000210558 Chr8:23805635..23805729 AAGAACAGAGACCGCTGGTG Chr8:23805659..23805678 60.44 55
upstream ENSMUSE00000210559 Chr8:23804287..23804404 CTGAACCATCCCAATGTGGT Chr8:23804384..23804403 60.63 50
upstream ENSMUSE00000210546 Chr8:23801530..23801599 TACCCTGCTGAGTGACATCG Chr8:23801530..23801549 59.85 55
upstream ENSMUSE00000210563 Chr8:23793198..23793286 CATCCATCGAGACCTGAAGC Chr8:23793233..23793252 60.77 55
upstream ENSMUSE00000210553 Chr8:23792135..23792224 GCAGTCTGTGCACGTCATTT Chr8:23792156..23792175 59.91 50
upstream ENSMUSE00000210552 Chr8:23789262..23789386 GCAGCAGAAGTACACCGTGA Chr8:23789350..23789369 60.06 55
upstream ENSMUSE00000210545 Chr8:23785435..23785542 TTCAAGTTCGCTACCCTTCC Chr8:23785451..23785470 59.31 50
upstream ENSMUSE00000258784 Chr8:23783835..23783964 AGCCCTGGATGACATCTTGA Chr8:23783843..23783862 60.62 50
upstream ENSMUSE00000258776 Chr8:23782795..23782989 CAGGCACCGTTCACACATAC Chr8:23782945..23782964 60.03 55
upstream ENSMUSE00000210554 Chr8:23782103..23782217 CACGTTGGACATGGATCTTG Chr8:23782184..23782203 59.96 50
upstream ENSMUSE00000258770 Chr8:23780079..23780202 ATCCAGACGCTGAAGGAAGA Chr8:23780115..23780134 59.95 50
upstream ENSMUSE00000210551 Chr8:23779417..23779568 AAACCAGCATCCAGATCGAC Chr8:23779454..23779473 60.08 50
upstream ENSMUSE00000210547 Chr8:23779156..23779217 GATAAATTGCTGCTGGCTTG Chr8:23779193..23779212 58.53 45
upstream ENSMUSE00000210557 Chr8:23777696..23777805 GTAGAGCGGATGATGGCACT Chr8:23777765..23777784 60.25 55
upstream ENSMUSE00000210556 Chr8:23776463..23776512 GAACAAGCGAGGGAGCTCTA Chr8:23776489..23776508 59.72 55
upstream ENSMUSE00000210562 Chr8:23776284..23776383 GACAGCCAGGAGATGGTACG Chr8:23776347..23776366 60.68 60
upstream ENSMUSE00000210543 Chr8:23775961..23776108 GCCTTATGAACGAGGACGAG Chr8:23776027..23776046 59.84 55

*** Putative Vector Insertion (Chr 8: 23774290 - 23775960) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210561 Chr8:23774162..23774289 GAAGGCTGGGACATTAGCTG Chr8:23774179..23774198 59.84 55
downstream ENSMUSE00000461720 Chr8:23771874..23771964 TGCTCCTTCACAGTGTCCTG Chr8:23771868..23771887 60.02 55
downstream ENSMUSE00000489153 Chr8:23770238..23771964 GTGAGCAGGTTAGCGAGGAC Chr8:23771326..23771345 60.02 60
downstream ENSMUSE00000331303 Chr8:23769698..23770931 CTGGCAGAGTGAGATGTCCA Chr8:23770765..23770784 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTGAAGATCGCCTGTGT Chr8:23775957..23775977 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCTGAAGATCGCCTGTGT Chr8:23775957..23775977 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031537