Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7391
Trapped Gene
Rad54l2 (ENSMUSG00000040661)
Vector Insertion
Chr 9: 106656470 - 106691310
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) RRS530 (baygenomics) E066C10 (ggtc) D178C04 (ggtc) (ggtc)
(ggtc) E044E05 (ggtc) (ggtc) (ggtc) E076E06 (ggtc) E002B02 (ggtc)
(ggtc) E066C10 (ggtc) D178C04 (ggtc) (ggtc) (ggtc) P028F11 (ggtc)
E042H01 (ggtc) (ggtc) (ggtc) E076E06 (ggtc) D183A09 (ggtc) (ggtc)
E044E05 (ggtc) D178B03 (ggtc) (ggtc) (ggtc) E032G02 (ggtc) (ggtc)
FHCRC-GT-S18-3E1 (fhcrc) IST10746F8 (tigm) IST14578D5 (tigm) IST10043A7BBR1 (tigm)
IST12663D8 (tigm) IST12663D8 (tigm) IST14755B11 (tigm) IST10043B8 (tigm)
IST14817C12 (tigm) IST14175C5 (tigm) IST14152E12 (tigm) IST10061D11 (tigm)
IST14621H2 (tigm) IST14485A8 (tigm) IST14232F10 (tigm) IST10053G6 (tigm)
IST14634D11 (tigm) IST14307B10 (tigm) IST10454C11 (tigm) IST14999C2 (tigm)
IST11613G7 (tigm) IST10746F8 (tigm)
Private Clones OST449362 (lexicon) OST444582 (lexicon) OST435241 (lexicon) OST426538 (lexicon)
OST414788 (lexicon) OST408551 (lexicon) OST390739 (lexicon) OST388735 (lexicon)
OST373358 (lexicon) OST370054 (lexicon) OST366105 (lexicon) OST360755 (lexicon)
OST346983 (lexicon) OST341704 (lexicon) OST326638 (lexicon) OST318333 (lexicon)
OST318213 (lexicon) OST303179 (lexicon) OST303026 (lexicon) OST302054 (lexicon)
OST293126 (lexicon) OST290936 (lexicon) OST287019 (lexicon) OST280361 (lexicon)
OST280321 (lexicon) OST274148 (lexicon) OST270934 (lexicon) OST270050 (lexicon)
OST266222 (lexicon) OST265956 (lexicon) OST261757 (lexicon) OST246083 (lexicon)
OST236947 (lexicon) OST226917 (lexicon) OST186008 (lexicon) OST185464 (lexicon)
OST180492 (lexicon) OST171811 (lexicon) OST162569 (lexicon) OST138885 (lexicon)
OST51894 (lexicon) OST37567 (lexicon) OST30251 (lexicon) OST30181 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000470174 (Chr9:106691311..106691544 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCAGACACTGTCCAAGAGG Chr9:106691378..106691397 62.03 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000470174 (Chr9:106691311..106691544 -)
Downstram Exon
ENSMUSE00000419570 (Chr9:106656276..106656469 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCAGACACTGTCCAAGAGG Chr9:106691378..106691397 62.03 60 GTCATCCCTGTCATGCTCCT Chr9:106656273..106656292 60.08 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000470174 Chr9:106691311..106691544 CGCAGACACTGTCCAAGAGG Chr9:106691378..106691397 62.03 60

*** Putative Vector Insertion (Chr 9: 106656470 - 106691310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000419570 Chr9:106656276..106656469 GTCATCCCTGTCATGCTCCT Chr9:106656273..106656292 60.08 55
downstream ENSMUSE00000355096 Chr9:106625047..106625245 TGCTAGGATCTTGCCTTGGT Chr9:106625084..106625103 59.84 50
downstream ENSMUSE00000419551 Chr9:106622656..106622795 CTGCTGTGCTGCTTTGGTTA Chr9:106622722..106622741 60.19 50
downstream ENSMUSE00000419547 Chr9:106621939..106622055 GGAGTTGGGGACCATCACTA Chr9:106621995..106622014 59.78 55
downstream ENSMUSE00000419544 Chr9:106621244..106621470 GTGCAGCGTATCCTCCTCTC Chr9:106621408..106621427 59.98 60
downstream ENSMUSE00000259840 Chr9:106620080..106620262 GACTGTTTTGGCTGGCGTAT Chr9:106620073..106620092 60.14 50
downstream ENSMUSE00000259825 Chr9:106619517..106619650 TTTAAAGAACCGAGGCTGGA Chr9:106619521..106619540 59.82 45
downstream ENSMUSE00000259806 Chr9:106618392..106618588 TCAATGATGACGGGATGAGA Chr9:106618408..106618427 60.01 45
downstream ENSMUSE00000259794 Chr9:106615575..106615917 CGTTTAGGATAGGGCGTTCA Chr9:106615644..106615663 60.09 50
downstream ENSMUSE00000259770 Chr9:106614663..106614840 AGCCACTGGTACCACAATCC Chr9:106614685..106614704 59.85 55
downstream ENSMUSE00000259750 Chr9:106612999..106613250 GGTCTTGCTCATTGGCTAGG Chr9:106613162..106613181 59.84 55
downstream ENSMUSE00000259735 Chr9:106612665..106612783 TCACGCTTTCTTCAATCAGG Chr9:106612671..106612690 59 45
downstream ENSMUSE00000259714 Chr9:106610546..106610664 GCTGACATTTCGAACCCACT Chr9:106610531..106610550 60.12 50
downstream ENSMUSE00000259686 Chr9:106608099..106608198 ATTAATGAGCCGCTCCCTCT Chr9:106608130..106608149 60.19 50
downstream ENSMUSE00000259673 Chr9:106606396..106606601 TCCAGGAAGCATCGAATACC Chr9:106606515..106606534 60.04 50
downstream ENSMUSE00000259654 Chr9:106605823..106605995 CAGGCAAGTTGCAAGACTGA Chr9:106605829..106605848 60.17 50
downstream ENSMUSE00000259625 Chr9:106604976..106605172 GCAATGACTCGTGCTCAAAA Chr9:106605126..106605145 59.99 45
downstream ENSMUSE00000259606 Chr9:106602826..106603025 TGGACTGTACAGGACGAACG Chr9:106602945..106602964 59.74 55
downstream ENSMUSE00000259587 Chr9:106600449..106600538 CAGCATTGATTCTTGCCTGA Chr9:106600460..106600479 59.95 45
downstream ENSMUSE00000259556 Chr9:106598203..106598295 TCACTGGTGCGGATGTATGT Chr9:106598252..106598271 59.99 50
downstream ENSMUSE00000335378 Chr9:106590413..106596041 GCAGGGGCTTCCTAGCTACT Chr9:106595010..106595029 60 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCACCTTGGCTCTGATTTA Chr9:106673280..106673301 59.32 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCACCTTGGCTCTGATTTA Chr9:106673280..106673301 59.32 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCAGTCTTGGCCTTAGATTC Chr9:106673562..106673583 60.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCCAGTCTTGGCCTTAGATTC Chr9:106673562..106673583 60.08 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040661