Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7395
Trapped Gene
Crmp1 (ENSMUSG00000029121)
Vector Insertion
Chr 5: 37637336 - 37656470
Public Clones (sanger) RRS553 (baygenomics) RRF515 (baygenomics)
Private Clones OST30572 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000546315 (Chr5:37637031..37637335 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATGTCTCATCAGGGGAAG Chr5:37637295..37637314 60.47 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000546315 (Chr5:37637031..37637335 +)
Downstram Exon
ENSMUSE00000546344 (Chr5:37656471..37656559 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATGTCTCATCAGGGGAAG Chr5:37637295..37637314 60.47 55 ACATCGGCGTAGAAGGACTG Chr5:37656538..37656557 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000546345 Chr5:37633384..37633764 ATCGACTTCGACGCCTACAG Chr5:37633525..37633544 60.42 55
upstream ENSMUSE00000546315 Chr5:37637031..37637335 CCATGTCTCATCAGGGGAAG Chr5:37637295..37637314 60.47 55

*** Putative Vector Insertion (Chr 5: 37637336 - 37656470) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000546344 Chr5:37656471..37656559 ACATCGGCGTAGAAGGACTG Chr5:37656538..37656557 60.28 55
downstream ENSMUSE00000400790 Chr5:37659922..37660106 CACTCCACCAGGAACAATCA Chr5:37659961..37659980 59.52 50
downstream ENSMUSE00000185817 Chr5:37664586..37664750 CTCTTCCCGAACACCATCAT Chr5:37664728..37664747 59.93 50
downstream ENSMUSE00000185816 Chr5:37667516..37667577 CTGGCTGTCAGACATCTGGT Chr5:37667580..37667599 58.83 55
downstream ENSMUSE00000185809 Chr5:37669324..37669404 CCCAAACCCTTAAGGAAGGT Chr5:37669361..37669380 59.32 50
downstream ENSMUSE00000185812 Chr5:37670102..37670170 TCCAGGATCCGTTTTTGTTC Chr5:37670124..37670143 59.91 45
downstream ENSMUSE00000185814 Chr5:37670898..37671018 ATGATGTCCGCTGCACTCTT Chr5:37671001..37671020 60.83 50
downstream ENSMUSE00000653836 Chr5:37670898..37670976 GGTGATGTACACAGGGCAAT Chr5:37670969..37670988 58.29 50
downstream ENSMUSE00000185811 Chr5:37671706..37671862 AGGGGAAGTCACAAATGCAG Chr5:37671812..37671831 60.11 50
downstream ENSMUSE00000185808 Chr5:37674091..37674232 AACGGTCATCCGCTCTTCTA Chr5:37674217..37674236 59.84 50
downstream ENSMUSE00000185807 Chr5:37675267..37675437 GGTGACGGCTACAAACTGGT Chr5:37675311..37675330 60.03 55
downstream ENSMUSE00000185818 Chr5:37677607..37677786 TGACACGCTGGTAGAGATGC Chr5:37677775..37677794 60.02 55
downstream ENSMUSE00000653834 Chr5:37677674..37677786 CTGATCCTGACACGCTGGTA Chr5:37677782..37677801 59.85 55
downstream ENSMUSE00000185810 Chr5:37680044..37680209 TGGGGGTTGGTGTTTAGAAG Chr5:37680172..37680191 59.82 50
downstream ENSMUSE00000698322 Chr5:37682356..37683371 CCTGTACGCCTTGGATTGTT Chr5:37682395..37682414 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGTCTCATCAGGGGAAG Chr5:37655296..37655316 60.47 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGTCTCATCAGGGGAAG Chr5:37655296..37655316 60.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029121