Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7408
Trapped Gene
Icmt (ENSMUSG00000039662)
Vector Insertion
Chr 4: 151671678 - 151672793
Public Clones RRE013 (baygenomics) RRS625 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000523809 (Chr4:151671393..151671677 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTCGCTACATTCCTCCT Chr4:151671531..151671550 60.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000523809 (Chr4:151671393..151671677 +)
Downstram Exon
ENSMUSE00000304086 (Chr4:151672794..151672882 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTCGCTACATTCCTCCT Chr4:151671531..151671550 60.37 55 ATTCCAAGAGGACTGGCTGA Chr4:151672874..151672893 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523809 Chr4:151671393..151671677 AGCCTCGCTACATTCCTCCT Chr4:151671531..151671550 60.37 55

*** Putative Vector Insertion (Chr 4: 151671678 - 151672793) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000304086 Chr4:151672794..151672882 ATTCCAAGAGGACTGGCTGA Chr4:151672874..151672893 59.8 50
downstream ENSMUSE00000630153 Chr4:151673246..151673279 No primer for this exon
downstream ENSMUSE00000304081 Chr4:151673780..151673949 AGAGACAGCGAGCACACGTA Chr4:151673803..151673822 59.8 55
downstream ENSMUSE00000304077 Chr4:151674646..151674863 CATTCTCCGAAGACCACCAT Chr4:151674709..151674728 59.93 50
downstream ENSMUSE00000705439 Chr4:151677131..151678137 TATTCAGCACGGCAACTCTG Chr4:151677713..151677732 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCTGCTGCTACTCTACC Chr4:151671642..151671662 58.03 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGCTGCTGCTACTCTACC Chr4:151671642..151671662 58.03 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039662