Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7409
Trapped Gene
Tbp (ENSMUSG00000014767)
Vector Insertion
Chr 17: 15644395 - 15650493
Public Clones RRS626 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000135927 (Chr17:15644307..15644394 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000135927 (Chr17:15644307..15644394 +)
Downstram Exon
ENSMUSE00000135925 (Chr17:15650494..15650585 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718123 Chr17:15636852..15636988 No primer for this exon
upstream ENSMUSE00000717118 Chr17:15636874..15636988 No primer for this exon
upstream ENSMUSE00000358970 Chr17:15636901..15636988 No primer for this exon
upstream ENSMUSE00000721171 Chr17:15636924..15637190 No primer for this exon
upstream ENSMUSE00000707531 Chr17:15638118..15638166 No primer for this exon
upstream ENSMUSE00000718328 Chr17:15638276..15638321 No primer for this exon
upstream ENSMUSE00000364010 Chr17:15639929..15640092 No primer for this exon
upstream ENSMUSE00000712984 Chr17:15639929..15640092 No primer for this exon
upstream ENSMUSE00000135929 Chr17:15641238..15641611 No primer for this exon
upstream ENSMUSE00000135927 Chr17:15644307..15644394 No primer for this exon

*** Putative Vector Insertion (Chr 17: 15644395 - 15650493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135925 Chr17:15650494..15650585 No primer for this exon
downstream ENSMUSE00000555433 Chr17:15651194..15651361 No primer for this exon
downstream ENSMUSE00000135923 Chr17:15652580..15652674 No primer for this exon
downstream ENSMUSE00000363369 Chr17:15653668..15654391 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGACCTGGGACCTACAGCA Chr17:15644383..15644403 61.27 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr17:15644442..15644462 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014767