Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7417
Trapped Gene
Srebf2 (ENSMUSG00000022463)
Vector Insertion
Chr 15: 82009978 - 82012410
Public Clones RRS740 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251620 (Chr15:82009796..82009977 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGTTTGACTGGATGGTT Chr15:82009805..82009824 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251620 (Chr15:82009796..82009977 +)
Downstram Exon
ENSMUSE00000127191 (Chr15:82012411..82012687 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGTTTGACTGGATGGTT Chr15:82009805..82009824 59.97 50 GCACGGATAAGCAGGTTTGT Chr15:82012462..82012481 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435004 Chr15:81977696..81977920 GAGACCATGGAGACCCTCAC Chr15:81977863..81977882 59.49 60
upstream ENSMUSE00000127185 Chr15:82000168..82000584 TGGGAGAGTTCCCTGATTTG Chr15:82000195..82000214 60.04 50
upstream ENSMUSE00000647452 Chr15:82000168..82000248 TGGGAGAGTTCCCTGATTTG Chr15:82000195..82000214 60.04 50
upstream ENSMUSE00000525437 Chr15:82000369..82000584 AGACGAGGATCATCCAGCAG Chr15:82000528..82000547 60.37 55
upstream ENSMUSE00000251647 Chr15:82001532..82001713 CAAGTGCAAAGCCTCGTGAC Chr15:82001543..82001562 61.97 55
upstream ENSMUSE00000127211 Chr15:82003183..82003329 GTCCTGGTGCAACCTCAGAT Chr15:82003183..82003202 60.12 55
upstream ENSMUSE00000127205 Chr15:82005527..82005748 GAGGCGGACAACACACAATA Chr15:82005649..82005668 59.57 50
upstream ENSMUSE00000127175 Chr15:82007586..82007700 AAGTCTGGCGTTCTGAGGAA Chr15:82007592..82007611 59.99 50
upstream ENSMUSE00000127179 Chr15:82007836..82008017 TCTGGTGGACAGTGATGTGG Chr15:82007864..82007883 60.59 55
upstream ENSMUSE00000127177 Chr15:82009147..82009339 ATGAACCGGACTCTCCTCCT Chr15:82009154..82009173 60.07 55
upstream ENSMUSE00000251620 Chr15:82009796..82009977 GCTGGTTTGACTGGATGGTT Chr15:82009805..82009824 59.97 50

*** Putative Vector Insertion (Chr 15: 82009978 - 82012410) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127191 Chr15:82012411..82012687 GCACGGATAAGCAGGTTTGT Chr15:82012462..82012481 60.14 50
downstream ENSMUSE00000251613 Chr15:82015694..82015863 GATTTTCTCCTCCGCACACT Chr15:82015782..82015801 59.29 50
downstream ENSMUSE00000127192 Chr15:82022636..82022804 ACAGACTCTGGGCACGATTT Chr15:82022669..82022688 59.73 50
downstream ENSMUSE00000251599 Chr15:82024475..82024592 CACCGCTCTTTCTAGCAGGT Chr15:82024536..82024555 59.64 55
downstream ENSMUSE00000351926 Chr15:82025345..82025454 CACAAATCCCACAGAGTCCA Chr15:82025414..82025433 59.52 50
downstream ENSMUSE00000251587 Chr15:82026590..82026722 CAGTAAAACGAGAGCGCACA Chr15:82026688..82026707 60.19 50
downstream ENSMUSE00000251576 Chr15:82028048..82028216 GACGTTGAGACTGCTCCACA Chr15:82028186..82028205 60.03 55
downstream ENSMUSE00000127197 Chr15:82030065..82030250 CAGCGACAGTAGCAGGTCAC Chr15:82030106..82030125 59.65 60
downstream ENSMUSE00000127215 Chr15:82033615..82033726 AGCTGGTGTGTACGGGTAGG Chr15:82033682..82033701 60.05 60
downstream ENSMUSE00000389673 Chr15:82034127..82035806 AGGGAAGATCCTGGGAGAAA Chr15:82034414..82034433 60.01 50
downstream ENSMUSE00000647446 Chr15:82034127..82034266 GATGGCAGTAGCTCGCTCTC Chr15:82034176..82034195 60.27 60
downstream ENSMUSE00000647445 Chr15:82034457..82034555 CAAAAGCCTTGGCAGGTAAC Chr15:82034517..82034536 59.75 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCAAAGTGAGTTCCGTCAT Chr15:82009973..82009993 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGCGTGACTGGGAAAAC Chr15:82010024..82010044 60.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022463